Mutation Details for c.1323_1344delGAAAGATATTAATTTCAAGATA
|
Note: this mutation was submitted but not yet reviewed by our curator.
|
|
cDNA Name
|
c.1323_1344delGAAAGATATTAATTTCAAGATA
|
|
Protein Name
|
p.Asp443GlufsX19
|
|
Exon or Intron
|
|
|
Other Details
|
This variant was found in one Azerbaijani patient in homozygous condition
|
|
Contributors and Institutes
|
| Petrova Nika, Kondratyeva Elena, | - | Research Centre for Medical Genetics, Moscow, Russia, |
|
|
Submitted Phenotype Details
|
|
|
Reference
|
|
To check if there are any papers published about this mutation/variant on PubMed, please click here.
|
|
|
|
|
