Mutation Details for c.2479G>T

cDNA Name c.2479G>T 
Protein Name p.Glu827X 
Exon or Intron exon 14 
Legacy Exon or Intron exon 13 
Legacy Name E827X 
Other Details The nucleotide change was found by using DGGE and direct sequencing of the PCR product showing an altered mobility in the gel. It was observed once among 50 CF chromosomes and is carried on a C haplotype. Clinical data in that family may potentially be of interest because there were four affected male children (genotype [delta]F508/G827X) with a severe form of the disease. Three are still alive and have developed cirrhosis in the first years of their life. The G827X destroys two MboII site in the normal sequence so PCR product obtained using TCAATCCAATCAACTCTATACGA and ATCATAGGATTAGGATAAGGTGTA as primers leads to (291+110+81+12+3) for the normal sequence and (291+125+81) for the mutated one after MboII digestion. 
Contributors Audrezet MP, Guillermit H, Mercier B, Quere I, Verlingue C, Ferec C   1991-12-06
Institute Centre de Transfusion Sanguine et de Biogenetique Brest, France 
Submitted Phenotype Details The deceased French CF patient (male) carried deltaF508 on the other allele. (pers.corr. Ferec) 
Reference FĂ©rec et al. 1991 

To check if there are any papers published about this mutation/variant on PubMed, please click here.

Comments or questions? Please email to cftr.admin
The Database was last updated at Apr 25, 2011