Mutation Details for c.1584+51_1584_61dup11

cDNA Name c.1584+51_1584_61dup11 
Exon or Intron intron 11 
Legacy Exon or Intron intron 10 
Legacy Name dup1716+51->61 
Other Details The 5' end sequence of intron 10 of a dup1716+(51->61) allele is the following one: 5'-GTAAGAAACTATGTGAAAACTTTTTGATTATGCATATGAACCCTTCACAC TACCCAAATTATACCCAAATTATATATTTGGCTCCATATTC-3' The mutation was found in 3 out of 272 random Algerian chromosomes. It was not found in 66 Belgian CF chromosomes,nor in 62 Belgian normal chromosomes. At this moment we have no reasons to believe that this mutation is a disease mutation. The mutation can be detected by means of heteroduplex formation. 
Contributors Cuppens H, Loumi O, Marynen P, Cassiman JJ   1991-07-31
Institute Universitiare Ziekenhuizen Leuven, Belgium 
Submitted Phenotype Details dup1716+51->61 was observed in 3 random Algerian individuals (likely a polymorphism): Cuppens et al. 1992. and pers. corr. Cuppens 
Reference Cuppens et al. 1992 

To check if there are any papers published about this mutation/variant on PubMed, please click here.

Comments or questions? Please email to cftr.admin
The Database was last updated at Apr 25, 2011