The cystic fibrosis transmembrane conductance regulator (CFTR) is a 1480 amino acid membrane bound glycoprotein with
a molecular mass of 170,000. It is a member of the ATP binding cassette (ABC)superfamily of proteins. The protein is
comprised of two, six span membrane bound regions each connected to a nuclear binding factor which binds ATP.
Between these two units is an R-domain which is comprised of many charged amino acids. The R-domain is a unique
feature of CFTR within the ABC superfamily.
Put your mouse over the domain region in the following graph to view the summary of that domain, click to view the
details.
Many of the mutations identified in CF occur in the first nuclear binding domain (NBF1), while very few occur in NBF2. This is a common feature of the ABC superfamily and indicates a separate role for the two binding domains. The most common mutation in CF DF508 occurs in NBF1. This results in a 3 bp deletion and the loss of a phenylalanine residue. The deletion causes a protein trafficking defect. If this defect is overcome then the protein can form a functional channel. This can be brought about by overexpression of CFTR or by culturing cells at > 30 oC.
The NBFs contain a number of highly conserved motifs predicted to bind and hydrolyse ATP. Site directed mutagenesis at these motifs have indicated that ATP binds to both NBFs to control the gating of the channel.
The mutations happenning in NBD1 domain:
|
cDNA Name
|
Protein Name
|
Legacy Name
|
Region
|
Description
|
Consequence
|
|
c.1429C>T
|
p.Pro477Ser
|
|
exon 11
|
|
|
|
c.1433_1434delCA
|
p.Ser478X
|
1565 del CA
|
exon 11
|
deletion of CA from 1565
|
frameshift
|
|
c.1435G>T
|
p.Glu479X
|
E479X
|
exon 11
|
G to T at 1567
|
Glu to Stop at 479
|
|
c.1437G>C
|
p.Glu479Asp
|
|
|
|
|
|
c.1438G>T
|
p.Gly480Cys
|
G480C
|
exon 11
|
G to T at 1570
|
Gly to Cys at 480
|
|
c.1438G>A
|
p.Gly480Ser
|
G480S
|
exon 11
|
G to A at 1570
|
Gly to Ser at 480
|
|
c.1439delG
|
p.Gly480ValfsX47
|
1571delG
|
exon 11
|
deletion of G at 1571
|
frameshift
|
|
c.1439G>A
|
p.Gly480Asp
|
G480D
|
exon 11
|
G to A at 1571
|
Gly to Asp at 480
|
|
c.1440T>C
|
|
1572T/C
|
exon 11
|
T or C at 1572
|
sequence variation
|
|
c.1444_1445insT
|
p.Lys483X
|
1576insT
|
exon 11
|
insertion of T at 1576
|
framshift
|
|
c.1450C>T
|
p.His484Tyr
|
H484Y
|
exon 11
|
C to T at 1582
|
His to Tyr at 484 (CBAVD?)
|
|
c.1451A>G
|
p.His484Arg
|
H484R
|
exon 11
|
A to G at 1583
|
His to Arg at 484
|
|
c.1453A>T
|
p.Ser485Cys
|
S485C
|
exon 11
|
A to T at 1585
|
Ser to Cys at 485
|
|
c.1454G>C
|
p.Ser485Thr
|
S485T
|
exon 11
|
G to C at 1586
|
|
|
c.1456G>T
|
p.Gly486X
|
G486X
|
exon 11
|
G to T at 1588
|
Gly to Stop at 486
|
|
c.1465_1468delTCAT
|
p.Phe490ValfsX36
|
|
|
|
|
|
c.1466C>A
|
p.Ser489X
|
S489X
|
exon 11
|
C to A at 1598
|
Ser to Stop at 489
|
|
c.1469_1470delTC
|
p.Phe490LeufsX13
|
1601delTC
|
exon 11
|
deletion of TC from 1601 or CT from 1602
|
frameshift
|
|
c.1469delT
|
p.Phe490Serfs*37
|
|
exon 11
|
|
|
|
c.1471T>C
|
p.Cys491Arg
|
C491R
|
exon 11
|
T to C at 1603
|
Cys to Arg at 491
|
|
c.1472G>C
|
p.Cys491Ser
|
|
exon 11
|
|
|
|
c.1472G>T
|
p.Cys491Phe
|
|
|
|
|
|
c.1475C>T
|
p.Ser492Phe
|
S492F
|
exon 11
|
C to T at 1607
|
Ser to Phe at 492
|
|
c.1477_1478delCA
|
p.Gln493ValfsX10
|
1609delCA
|
exon 11
|
deletion of CA from 1609
|
frameshift
|
|
c.1477C>T
|
p.Gln493X
|
Q493X
|
exon 11
|
C to T at 1609
|
Gln to Stop at 493
|
|
c.1478A>C
|
p.Gln493Pro
|
Q493P
|
exon 11
|
A to C at 1610
|
Gln to Pro at 493
|
|
c.1478A>G
|
p.Gln493Arg
|
Q493R
|
exon 11
|
A to G at 1610
|
Gln to Arg at 493
|
|
c.1479G>A
|
p.Gln493Gln
|
|
|
|
|
|
c.1482_1483delTT
|
p.Ser495LeufsX8
|
1612delTT
|
exon 11
|
deletion of TT from 1612
|
frameshift
|
|
c.1484C>A
|
p.Ser495Tyr
|
|
exon 11
|
|
|
|
c.1486T>C
|
p.Trp496Arg
|
|
|
|
|
|
c.1487G>A
|
p.Trp496X
|
W496X
|
exon 11
|
G to A at 1619
|
Trp to Stop at 496
|
|
c.1489A>G
|
p.Ile497Val
|
I497V
|
exon 11
|
A to G at 1621
|
Ile to Val at 497
|
|
c.1494G>C
|
p.Met498Ile
|
M498I
|
exon 11
|
G to C at 1626
|
Met (ATG) to Ileu (ATC) at 498
|
|
c.1495C>G
|
p.Pro499Ala
|
P499A
|
exon 11
|
C to G at 1627
|
Pro to Ala at 499 (CBAVD)
|
|
c.1501A>G
|
p.Thr501Ala
|
T501A
|
exon 11
|
A to G at 1633
|
Thr to Ala at 501
|
|
c.1505T>A
|
p.Ile502Asn
|
I502N
|
exon 11
|
T to A at 1637
|
Ile to Asn at 502
|
|
c.1505T>C
|
p.Ile502Thr
|
I502T
|
exon 11
|
T to C at 1637
|
Ile to Thr at 502
|
|
c.1510G>C
|
p.Glu504Gln
|
E504Q
|
exon 11
|
G to C at 1642
|
Glu to Gln at 504
|
|
c.1510G>T
|
p.Glu504X
|
E504X
|
exon 11
|
G to T at 1642
|
Glu to Stop at 504
|
|
c.1519_1521delATC
|
p.Ile507del
|
[delta]I507
|
exon 11
|
deletion of 3 bp between 1648 and 1653
|
deletion of Ile506 or Ile507
|
|
c.1516A>C
|
p.Ile506Leu
|
I506L
|
exon 11
|
A to C at 1648
|
Ile to Leu at 506
|
|
c.1516A>G
|
p.Ile506Val
|
I506V (1648A/G)
|
exon 11
|
A or G at 1648
|
Ile or Val at 506
|
|
c.1517T>G
|
p.Ile506Ser
|
I506S
|
exon 11
|
T to G at 1649
|
Ile to Ser at 506
|
|
c.1517T>C
|
p.Ile506Thr
|
I506T
|
exon 11
|
T to C at 1649
|
Ile to Thr at 506
|
|
c.1518C>G
|
p.Ile506Met
|
1650C/G
|
exon 11
|
C to G at 1650
|
Ile to Met at 506; sequence variation
|
|
c.1519A>G
|
p.Ile507Val
|
1651A/G
|
exon 11
|
A or G at 1651
|
sequence variation
|
|
c.1521_1523delCTT
|
p.Phe508del
|
[delta]F508
|
exon 11
|
deletion of 3 bp between 1652 and 1655
|
deletion of Phe at 508
|
|
c.1521C>G
|
p.Ile507Met
|
|
exon 11
|
|
|
|
c.1523T>G
|
p.Phe508Cys
|
F508C
|
exon 11
|
T to G at 1655
|
Phe to Cys at 508
|
|
c.1523T>C
|
p.Phe508Ser
|
F508S
|
exon 11
|
T to C at 1655
|
Phe to Ser at 508
|
|
c.1526G>A
|
p.Gly509Asp
|
|
|
|
|
|
c.1528delG
|
p.Val510PhefsX17
|
1660delG
|
exon 11
|
Deletion of G at 1660
|
frameshift
|
|
c.1532C>G
|
p.Ser511Cys
|
|
exon 11
|
|
|
|
c.1538A>G
|
p.Asp513Gly
|
D513G
|
exon 11
|
A to G at 1670
|
Asp to Gly at 513 (CBAVD)
|
|
c.1540G>C
|
p.Glu514Gln
|
|
|
|
|
|
c.1540G>A
|
p.Glu514Lys
|
|
|
|
|
|
c.1543T>C
|
p.Tyr515His
|
Y515H
|
exon 11
|
T to C at 1675
|
Tyr to His at 515
|
|
c.1545_1546delTA
|
p.Tyr515X
|
1677delTA
|
exon 11
|
deletion of TA from 1677
|
frameshift
|
|
c.1546A>G
|
p.Arg516Gly
|
R516G
|
exon 11
|
A to G at 1678
|
Arg to Gly at 516
|
|
c.1549T>C
|
p.Tyr517His
|
|
|
|
|
|
c.1550A>G
|
p.Tyr517Cys
|
Y517C
|
exon 11
|
A to G at 1682
|
Tyr to Cys at 517
|
|
c.1555A>G
|
p.Ser519Gly
|
S519G
|
exon 11
|
A to G at 1687
|
Ser to Gly at 519
|
|
c.1558G>T
|
p.Val520Phe
|
V520F
|
exon 11
|
G to T at 1690
|
Val to Phe at 520
|
|
c.1558G>A
|
p.Val520Ile
|
V520I
|
exon 11
|
G to A at 1690
|
Val to Ile at 520
|
|
c.1561A>C
|
p.Ile521Leu
|
1693A- >C
|
exon 11
|
A to C at 1693
|
Ile to Leu at 521 (sequence variation?)
|
|
c.1561A>T
|
p.Ile521Phe
|
|
exon 11
|
|
|
|
c.1567G>T
|
p.Ala523Ser
|
|
exon 11
|
|
|
|
c.1572C>A
|
p.Cys524X
|
C524X
|
exon 11
|
C to A at 1704
|
Cys to Stop at 524
|
|
c.1573C>T
|
p.Gln525X
|
Q525X
|
exon 11
|
C to T at 1705
|
Gln to Stop at 525
|
|
c.1573delC
|
p.Gln525AsnfsX2
|
|
|
|
|
|
c.1574_1590delAACTAGAAGAGGACATC
|
p.Gln525LeufsX37
|
1706del17
|
exon 11
|
deletion of 17 bp from 1706
|
deletion of splice site
|
|
c.1579G>C
|
p.Glu527Gln
|
E527Q
|
exon 11
|
G to C at 1711
|
Glu to Gln at 527
|
|
c.1580A>G
|
p.Glu527Gly
|
E527G
|
exon 11
|
A to G at 1712
|
Glu to Gly at 527
|
|
c.1581A>G
|
|
1713A/G
|
exon 11
|
A or G at 1713
|
sequence variation
|
|
c.1582G>A
|
p.Glu528Lys
|
E528K
|
exon 11
|
G to A at 1714
|
Glu to Lys at 528
|
|
c.1584G>A
|
|
1716G/A
|
exon 11
|
G or A at 1716
|
sequence variation
|
|
c.1584G>T
|
p.Glu528Asp
|
E528D
|
exon 11
|
G to T at 1716
|
Glu to Asp at 528 (splice mutation?)
|
|
c.1585G>C
|
p.Asp529His
|
D529H
|
exon 12
|
G to C at 1717
|
Asp to His at 529
|
|
c.1586A>G
|
p.Asp529Gly
|
D529G
|
exon 12
|
A to G at 1718
|
Asp to Gly at 529
|
|
c.1588A>C
|
p.Ile530Leu
|
|
exon 12
|
|
|
|
c.1597T>C
|
p.Phe533Leu
|
|
|
|
|
|
c.1597T>G
|
p.Phe533Val
|
|
|
|
|
|
c.1601C>A
|
p.Ala534Glu
|
A534E
|
exon 12
|
C to A at 1733
|
Ala to Glu at 534
|
|
c.1606A>G
|
p.Lys536Glu
|
K536E
|
exon 12
|
A to G at 1738
|
|
|
c.1606A>T
|
p.Lys536X
|
K536X
|
exon 12
|
A to T at 1738
|
Lys to Stop codon at 536
|
|
c.1610_1611delAC
|
p.Asp537GlufsX30
|
1742delAC
|
exon 12
|
deletion of AC from 1742
|
frameshift
|
|
c.1611C>A
|
p.Asp537Glu
|
D537E
|
exon 12
|
C to A or C to G at 1743
|
Asp to Glu at 537
|
|
c.1616T>C
|
p.Ile539Thr
|
I539T
|
exon 12
|
T to C at 1748
|
Ile to Thr at 539
|
|
c.1617_1618insTA
|
p.Val540X
|
1749insTA
|
exon 12
|
insertion of TA at 1749
|
frameshift resulting in premature termination at 540
|
|
c.1622T>C
|
p.Leu541Pro
|
|
exon 12
|
|
|
|
c.1624G>T
|
p.Gly542X
|
G542X
|
exon 12
|
G to T at 1756
|
Gly to Stop at 542
|
|
c.1625G>A
|
p.Gly542Glu
|
G542E
|
exon 12
|
1757G>A
|
|
|
c.1630G>A
|
p.Gly544Ser
|
G544S
|
exon 12
|
G to A at 1762
|
Gly to Ser at 544
|
|
c.1631G>T
|
p.Gly544Val
|
G544V
|
exon 12
|
G to T at 1763
|
Gly to Val at 544 (CBAVD)
|
|
c.1632T>G
|
|
1764T/G
|
exon 12
|
T or G at 1764
|
sequence variation
|
|
c.1635_1640del
|
p.Ile546_Thr547del
|
1767del6
|
exon 12
|
delete 6 nucleotide from 1767
|
In frame in/del
|
|
c.1641A>T
|
|
1773A/T
|
exon 12
|
A or T at 1773
|
sequence variation
|
|
c.1642_1643delCT
|
p.Leu548GlufsX19
|
1774delCT
|
exon 12
|
deletion of CT from 1774
|
frameshift
|
|
c.1643T>A
|
p.Leu548Gln
|
L548Q
|
exon 12
|
T to A at 1775
|
Leu to Gln at 548
|
|
c.1645A>C
|
p.Ser549Arg
|
S549R(A- >C)
|
exon 12
|
A to C at 1777
|
Ser to Arg at 549
|
|
c.1645_1648delAGTG
|
p.Ser549GlufsX9
|
|
exon 12
|
|
|
|
c.1646G>T
|
p.Ser549Ile
|
S549I
|
exon 12
|
G to T at 1778
|
Ser to Ile at 549
|
|
c.1646G>A
|
p.Ser549Asn
|
S549N
|
exon 12
|
G to A at 1778
|
Ser to Asn at 549
|
|
c.1647T>G
|
p.Ser549Arg
|
S549R(T- >G)
|
exon 12
|
T to G at 1779
|
Ser to Arg at 549
|
|
c.1648G>A
|
p.Gly550Arg
|
G550R
|
exon 12
|
G to A at 1780
|
Gly to Arg at 550
|
|
c.1648G>T
|
p.Gly550X
|
G550X
|
exon 12
|
G to T at 1780
|
Gly to Stop at 550
|
|
c.1650delA
|
p.Gly551ValfsX8
|
1782delA
|
exon 12
|
deletion of A at 1782
|
frameshift
|
|
c.1651G>A
|
p.Gly551Ser
|
G551S
|
exon 12
|
G to A at 1783
|
Gly to Ser at 551
|
|
c.1652delG
|
p.Gly551ValfsX8
|
1784delG
|
exon 12
|
deletion of G at 1784
|
frameshift
|
|
c.1652G>A
|
p.Gly551Asp
|
G551D
|
exon 12
|
G to A at 1784
|
Gly to Asp at 551
|
|
c.1654C>A
|
p.Gln552Lys
|
Q552K
|
exon 12
|
C to A at 1786
|
Gln to Lys at 552
|
|
c.1654C>T
|
p.Gln552X
|
Q552X
|
exon 12
|
C to T at 1786
|
Gln to Stop at 552
|
|
c.1656delA
|
p.Gln552HisfsX7
|
1787delA
|
exon 12
|
deletion of A at position 1787 or 1788
|
frameshift, stop codon at 558
|
|
c.1657C>G
|
p.Arg553Gly
|
R553G
|
exon 12
|
C to G at 1789
|
Arg to Gly at 553
|
|
c.1657C>T
|
p.Arg553X
|
R553X
|
exon 12
|
C to T at 1789
|
Arg to Stop at 553
|
|
c.1658G>A
|
p.Arg553Gln
|
R553Q
|
exon 12
|
G to A at 1790
|
Arg to Gln at 553 (associated with [delta]F508;
|
|
c.1660_1661insA
|
p.Ala554AspfsX14
|
|
exon 12
|
|
|
|
c.1663A>G
|
p.Arg555Gly
|
R555G
|
exon 12
|
A to G at 1795
|
Arg to Gly at 555
|
|
c.1666A>G
|
p.Ile556Val
|
I556V
|
exon 12
|
A to G at 1798
|
Ile to Val at 556 (mutation?)
|
|
c.1670delC
|
p.Ser557PhefsX2
|
1802delC
|
exon 12
|
deletion of C at 1802
|
frameshift
|
|
c.1673T>C
|
p.Leu558Ser
|
L558S
|
exon 12
|
T to C at 1805
|
Leu to Ser at 558
|
|
c.1674delA
|
p.Ala559GlnfsX13
|
1806delA
|
exon 12
|
deletion of A at 1806
|
frameshift
|
|
c.1675G>A
|
p.Ala559Thr
|
A559T
|
exon 12
|
G to A at 1807
|
Ala to Thr at 559
|
|
c.1675G>C
|
p.Ala559Pro
|
|
|
|
|
|
c.1675G>T
|
p.Ala559Ser
|
|
|
|
|
|
c.1676C>A
|
p.Ala559Glu
|
A559E
|
exon 12
|
C to A at 1808
|
Ala to Glu at 559
|
|
c.1676C>T
|
p.Ala559Val
|
A559V
|
exon 12
|
C to T at 1808
|
Ala to Val at 559
|
|
c.1678A>G
|
p.Arg560Gly
|
R560G
|
exon 12
|
A to G at 1810
|
Ala to Gly at 560
|
|
c.1679G>A
|
p.Arg560Lys
|
R560K
|
exon 12
|
G to A at 1811
|
Arg to Lys at 560
|
|
c.1679G>C
|
p.Arg560Thr
|
R560T
|
exon 12
|
G to C at 1811
|
Arg to Thr at 560; mRNA splicing defect?
|
|
c.1680A>C
|
p.Arg560Ser
|
R560S
|
exon 13
|
A to C at 1812
|
Arg to Ser at 560
|
|
c.1681_1682insC
|
p.Val562SerfsX6
|
1813insC
|
exon 13
|
insertion of C after 1813 (or 1814)
|
frameshift
|
|
c.1682C>A
|
p.Ala561Glu
|
A561E
|
exon 13
|
C to A at 1814
|
Ala to Glu at 561
|
|
c.1684G>A
|
p.Val562Ile
|
V562I
|
exon 13
|
G to A at 1816
|
Val to Ile at 562
|
|
c.1684G>C
|
p.Val562Leu
|
V562L
|
exon 13
|
G to C at 1816
|
Val to Leu at 562
|
|
c.1687T>G
|
p.Tyr563Asp
|
Y563D
|
exon 13
|
T to G at 1819
|
Tyr to Asp at 563
|
|
c.1687T>A
|
p.Tyr563Asn
|
Y563N
|
exon 13
|
T to A at 1819
|
Tyr to Asn at 563
|
|
c.1687T>C
|
p.Tyr563His
|
|
|
|
|
|
c.1688A>G
|
p.Tyr563Cys
|
Y563C
|
exon 13
|
A to G at 1820
|
Tyr to Cys at 563
|
|
c.1689C>A
|
p.Tyr563X
|
|
|
|
|
|
c.1690A>G
|
p.Lys564Glu
|
|
exon 13
|
A to G at 1690
|
|
|
c.1692delA
|
p.Asp565MetfsX7
|
1824delA
|
exon 13
|
1824delA
|
|
|
c.1694A>G
|
p.Asp565Gly
|
D565G
|
exon 13
|
A to G at 1826
|
Asp to Gly at 565
|
|
c.1696G>A
|
p.Ala566Thr
|
A566T
|
exon 13
|
G to A at 1828
|
Ala to Thr at 566
|
|
c.1697C>A
|
p.Ala566Asp
|
|
|
|
|
|
c.1700A>G
|
p.Asp567Gly
|
|
exon 13
|
|
|
|
c.1703delT
|
p.Leu568CysfsX4
|
1833delT
|
exon 13
|
deletion of T at 1833
|
frameshift
|
|
c.1703T>A
|
p.Leu568X
|
L568X
|
exon 13
|
T to A at 1835
|
Leu to Stop at 568
|
|
c.1704G>T
|
p.Leu568Phe
|
L568F
|
exon 13
|
G to T at 1836
|
Leu to Phe at 568 (CBAVD?)
|
|
c.1705T>G
|
p.Tyr569Asp
|
Y569D
|
exon 13
|
T to G at 1837
|
Tyr to Asp at 569
|
|
c.1705T>C
|
p.Tyr569His
|
Y569H
|
exon 13
|
T to C at 1837
|
Tyr to His at 569
|
|
c.1706A>G
|
p.Tyr569Cys
|
Y569C
|
exon 13
|
A to G at 1838
|
Tyr to Cys at 569
|
|
c.1707T>A
|
p.Tyr569X
|
Y569X
|
exon 13
|
T to A at 1839
|
Tyr to Stop at 569
|
|
c.1709T>A
|
p.Leu570X
|
|
|
|
|
|
c.1712T>C
|
p.Leu571Ser
|
L571S
|
exon 13
|
T to C at 1844
|
Leu to Ser at 571
|
|
c.1713_1714delAG
|
p.Asp572LeufsX16
|
1845delAG/1846delGA
|
exon 13
|
deletion of AG at 1845 or GA at 1846
|
frameshift
|
|
c.1714G>A
|
p.Asp572Asn
|
D572N
|
exon 13
|
G to A at 1846
|
Asp to Asn at 572
|
|
c.1714G>C
|
p.Asp572His
|
|
exon 13
|
|
|
|
c.1716C>A
|
p.Asp572Glu
|
|
|
|
|
|
c.1718C>G
|
p.Ser573Cys
|
S573C
|
exon 13
|
C to G at 1850
|
Ser to Cys at 573
|
|
c.1718C>T
|
p.Ser573Phe
|
|
|
|
|
|
c.1720C>T
|
p.Pro574Ser
|
P574S
|
exon 13
|
C to T at 1852
|
Pro to Ser at 574
|
|
c.1721C>A
|
p.Pro574His
|
P574H
|
exon 13
|
C to A at 1853
|
Pro to His at 574
|
|
c.1726G>T
|
p.Gly576X
|
G576X
|
exon 13
|
G to T at 1858
|
Gly to Stop at 576
|
|
c.1727G>C
|
p.Gly576Ala
|
G576A
|
exon 13
|
G to C at 1859
|
Gly to Ala at 576 (CAVD)
|
|
c.1730A>T
|
p.Tyr577Phe
|
Y577F
|
exon 13
|
A to T at 1862
|
Tyr to Phe at 577
|
|
c.1731C>T
|
|
Y577Y (1863C/T)
|
exon 13
|
C or T at 1863
|
sequence variation (Tyr at 577 no change)
|
|
c.1731C>A
|
p.Tyr577X
|
|
exon 13
|
|
|
|
c.1733_1734delTA
|
p.Leu578ArgfsX10
|
|
|
|
|
|
c.1735G>T
|
p.Asp579Tyr
|
D579Y
|
exon 13
|
G to T at 1867
|
Asp to Tyr at 579
|
|
c.1736A>C
|
p.Asp579Ala
|
D579A
|
exon 13
|
A to C at 1868
|
Asp to Ala at 579
|
|
c.1736A>G
|
p.Asp579Gly
|
D579G
|
exon 13
|
A to G at 1868
|
Asp to Gly at 579
|
|
c.1738delG
|
p.Val580PhefsX2
|
1870delG
|
exon 13
|
deletion of G at 1870
|
frameshift
|
|
c.1738G>A
|
p.Val580Ile
|
|
|
|
|
|
c.1739_1740insT
|
p.Leu581PhefsX8
|
1874insT
|
exon 13
|
insertion of T between 1871 and 1874
|
frameshift
|
|
c.1744A>T
|
p.Thr582Ser
|
T582S
|
exon 13
|
A to T at 1876
|
Thr to Ser at 582
|
|
c.1745C>T
|
p.Thr582Ile
|
T582I
|
exon 13
|
C to T at 1877
|
Thr to Ile at 582
|
|
c.1745C>G
|
p.Thr582Arg
|
T582R
|
exon 13
|
C to G at 1877
|
Thr to Arg at 582
|
|
c.1753G>T
|
p.Glu585X
|
E585X
|
exon 13
|
G to T at 1885
|
Glu to Stop at 585
|
|
c.1756A>G
|
p.Ile586Val
|
I586V
|
exon 13
|
A to G at 1888
|
Ile to Val at 586
|
|
c.1759T>A
|
p.Phe587Ile
|
F587I
|
exon 13
|
T to A at 1891
|
Phe to Ile at 587
|
|
c.1762G>T
|
p.Glu588X
|
|
|
|
|
|
c.1763A>T
|
p.Glu588Val
|
E588V
|
exon 13
|
A to T at 1895
|
Glu to Val at 588
|
|
c.1766G>T
|
p.Ser589Ile
|
S589I
|
exon 13
|
G to T at 1898
|
Ser to Ile at 589 (splicing?)
|
|
c.1766G>A
|
p.Ser589Asn
|
S589N
|
exon 13
|
G to A at 1898
|
Ser to Asn at 589 (mRNA splicing defect?)
|
|
c.53+642c>A
|
|
|
|
|
|
|
c.1781T>C
|
p.Leu594Pro
|
L594P
|
exon 14
|
T to C at 1913
|
Leu to Pro at 594
|
|
c.1783A>G
|
p.Met595Val
|
|
exon 14
|
|
|
|
c.1784T>C
|
p.Met595Thr
|
M595T
|
exon 14
|
T to C at 1916
|
Met to Thr at 595
|
|
c.1785G>A
|
p.Met595Ile
|
M595I
|
exon 14
|
G to A at 1917
|
Met to Ile at 595
|
|
c.1786_1787delGC
|
p.Ala596X
|
1918delGC
|
exon 14
|
deletion of GC from 1918
|
frameshift
|
|
c.1792_1798delAAAACTA
|
p.Lys598GlyfsX11
|
1924del7
|
exon 14
|
deletion of 7 bp (AAACTA) from 1924
|
frameshift
|
|
c.1792A>T
|
p.Lys598X
|
K598X
|
exon 14
|
A to T at 1924
|
Lys to Stop at 598
|
|
c.1797T>A
|
|
T599T (1929T/A)
|
exon 14
|
T or A at 1929
|
sequence variation
|
|
c.1798A>G
|
p.Arg600Gly
|
R600G
|
exon 14
|
A to G at 1930
|
Arg to Gly at 600
|
|
c.1800delG
|
p.Ile601PhefsX10
|
1932delG
|
exon 14
|
Deletion of G at nucleotide 1932
|
Frameshift a premature stop codon appears 10 codons further.
|
|
c.1801A>T
|
p.Ile601Phe
|
I601F
|
exon 14
|
A to T at 1933
|
Ile to Phe at 601
|
|
c.1801A>G
|
p.Ile601Val
|
|
|
|
|
|
c.1807G>T
|
p.Val603Phe
|
V603F
|
exon 14
|
G to T at 1939
|
Val to Phe at 603
|
|
c.1810A>C
|
p.Thr604Pro
|
|
|
|
|
|
c.1811C>T
|
p.Thr604Ile
|
T604I
|
exon 14
|
C to T at 1943
|
Thr to Ile at 604
|
|
c.1811C>G
|
p.Thr604Ser
|
T604S
|
exon 14
|
C to G at 1943
|
Thr to Ser at 604
|
|
c.1817_1900delAAATGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCC
|
p.Met607_Gln634del
|
1949del84
|
exon 14
|
deletion of 84 bp from 1949
|
deletion of 28 a.a. (Met607 to Gln634)
|
|
c.1819_1902delATGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCCAA
|
p.Met607_Gln634del
|
|
|
|
|
|
c.1823A>G
|
p.Glu608Gly
|
E608G
|
exon 14
|
A to G at 1955
|
Glu to Gly at 608
|
|
c.1826A>T
|
p.His609Leu
|
H609L
|
exon 14
|
A to T at 1958
|
His to Leu at 609
|
|
c.1826A>G
|
p.His609Arg
|
H609R
|
exon 14
|
A to G at 1958
|
His to Arg at 609
|
|
c.1829T>C
|
p.Leu610Ser
|
L610S
|
exon 14
|
T to C at 1961
|
Leu to Ser at 610
|
|
c.1837G>A
|
p.Ala613Thr
|
A613T
|
exon 14
|
G to A at 1969
|
Ala to Thr at 613
|
|
c.1840G>T
|
p.Asp614Tyr
|
D614Y
|
exon 14
|
G to T at 1972
|
Asp to Tyr at 614
|
|
c.1841A>G
|
p.Asp614Gly
|
D614G
|
exon 14
|
A to G at 1973
|
Asp to Gly at 614
|
|
c.1853T>C
|
p.Ile618Thr
|
I618T
|
exon 14
|
T to C at 1985
|
Ile to Thr at 618
|
|
c.1856T>C
|
p.Leu619Ser
|
L619S
|
exon 14
|
T to C at 1988
|
Leu to Ser at 619
|
|
c.1859A>C
|
p.His620Pro
|
H620P
|
exon 14
|
A to C at 1991
|
His to Pro at 620
|
|
c.1860T>G
|
p.His620Gln
|
H620Q
|
exon 14
|
T to G at 1992
|
His to Gln at 620
|
|
c.1865G>A
|
p.Gly622Asp
|
G622D
|
exon 14
|
G to A at 1997
|
Gly to Asp at 622 (oligospermia)
|
|
c.1871_1878delGCTATTTT
|
p.Ser624IlefsX15
|
2003del8
|
exon 14
|
Deletion of GCTATTTT from 2003
|
Frameshift
|
|
c.1874_1875delAT
|
p.Tyr625PhefsX16
|
|
|
|
|
|
c.1882G>A
|
p.Gly628Arg
|
G628R(G- >A)
|
exon 14
|
G to A at 2014
|
Gly to Arg at 628
|
|
c.1882G>C
|
p.Gly628Arg
|
G628R(G- >C)
|
exon 14
|
G to C at 2014
|
Gly to Arg at 628
|