Cystic Fibrosis Mutation Database: CFTR Domains

The cystic fibrosis transmembrane conductance regulator (CFTR) is a 1480 amino acid membrane bound glycoprotein with a molecular mass of 170,000. It is a member of the ATP binding cassette (ABC)superfamily of proteins. The protein is comprised of two, six span membrane bound regions each connected to a nuclear binding factor which binds ATP. Between these two units is an R-domain which is comprised of many charged amino acids. The R-domain is a unique feature of CFTR within the ABC superfamily.

Put your mouse over the domain region in the following graph to view the summary of that domain, click to view the details.

19 % of the CFTR protein make up the twelve transmembrane domains (M1 - M12). These domains have been shown to be comprised of typical a-helical secondary structure. Many of the residues within these regions form the channel lining residues and have a major role in the regulation of pore function. Six positively charged residues within the transmembrane domains [K95 (M1), R134 (M2), R334 (M6), K335 (M6), R347 (M6) and R1030 (M10] that are well conserved across species. Two of these are associated with mutations causing CF, R334Q/W and R347C/H/L/P.

The mutations happenning in MSD3 domain:

cDNA Name	Protein Name	Legacy Name	Region	Description	Consequence
c.720_741delAGGGAGAATGATGATGAAGTAC	p.Gly241GlufsX13	852del22	exon 6	deletion of 22 bp from 852	frameshift
c.721G>A	p.Gly241Arg	G241R	exon 6	G to A at 853	Gly to Arg at 241
c.727A>C	p.Met243Leu	M243L	exon 6	A to C at 859	Met to Leu at 243 (ATG to CTG)
c.727A>G	p.Met243Val
c.731T>A	p.Met244Lys	M244K	exon 6	T to A at 863	Met to Lys at 244
c.738G>A	p.Lys246Lys
c.741C>T		873C/T	exon 6	C or T at 873	sequence variation
c.741C>G	p.Tyr247X	Y247X	exon 6	C to G at 873	Tyr to Stop at 247
c.742_743insTACA	p.Arg248IlefsX?	874Ins TACA	exon 6	Insertion of 4 bp (TACA) at 874	stop codon at amino acid 257 in exon 6b
c.743G>C	p.Arg248Thr	R248T	exon 6	G to C at 875	Arg to Thr at 248 (CBAVD)
c.743G>A	p.Arg248Lys
c.744_1583dupAGATCAGAGAGCTGGGAAGATCAGTGAAAGACTTGTGATTACCTCAGAAATGATTGAAAATATCCAATCTGTTAAGGCATACTGCTGGGAAGAAGCAATGGAAAAAATGATTGAAAACTTAAGACAAACAGAACTGAAACTGACTCGGAAGGCAGCCTATGTGAGATACTTCAATAGCTCAGCCTTCTTCTTCTCAGGGTTCTTTGTGGTGTTTTTATCTGTGCTTCCCTATGCACTAATCAAAGGAATCATCCTCCGGAAAATATTCACCACCATCTCATTCTGCATTGTTCTGCGCATGGCGGTCACTCGGCAATTTCCCTGGGCTGTACAAACATGGTATGACTCTCTTGGAGCAATAAACAAAATACAGGATTTCTTACAAAAGCAAGAATATAAGACATTGGAATATAACTTAACGACTACAGAAGTAGTGATGGAGAATGTAACAGCCTTCTGGGAGGAGGGATTTGGGGAATTATTTGAGAAAGCAAAACAAAACAATAACAATAGAAAAACTTCTAATGGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCTTGGTACTCCTGTCCTGAAAGATATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGTTGCTGGATCCACTGGAGCAGGCAAGACTTCACTTCTAATGATGATTATGGGAGAACTGGAGCCTTCAGAGGGTAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGATTATGCCTGGCACCATTAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGATACAGAAGCGTCATCAAAGCATGCCAACTAGAAGA	p.Gln250_Asp529dup
c.-318_-314delAGGGA			promoter
c.769G>A	p.Glu257Lys	E257K	exon 7	901G>A
c.772A>G	p.Arg258Gly	R258G	exon 7	A to G at 904	Arg to Gly at 258
c.773delG	p.Arg258AsnfsX3	905delG	exon 7	deletion of G at 905	frameshift
c.775delinsTCTTCCTCAGATTCATTGTGATTACCTCA	p.Leu259SerfsX7		exon 7