The cystic fibrosis transmembrane conductance regulator (CFTR) is a 1480 amino acid membrane bound glycoprotein with a molecular mass of 170,000. It is a member of the ATP binding cassette (ABC)superfamily of proteins. The protein is comprised of two, six span membrane bound regions each connected to a nuclear binding factor which binds ATP. Between these two units is an R-domain which is comprised of many charged amino acids. The R-domain is a unique feature of CFTR within the ABC superfamily.

Put your mouse over the domain region in the following graph to view the summary of that domain, click to view the details.



19 % of the CFTR protein make up the twelve transmembrane domains (M1 - M12). These domains have been shown to be comprised of typical a-helical secondary structure. Many of the residues within these regions form the channel lining residues and have a major role in the regulation of pore function. Six positively charged residues within the transmembrane domains [K95 (M1), R134 (M2), R334 (M6), K335 (M6), R347 (M6) and R1030 (M10] that are well conserved across species. Two of these are associated with mutations causing CF, R334Q/W and R347C/H/L/P.

The mutations happenning in MSD3 domain:

cDNA Name Protein Name Legacy Name Region Description Consequence
c.720_741delAGGGAGAATGATGATGAAGTAC p.Gly241GlufsX13 852del22 exon 6 deletion of 22 bp from 852 frameshift
c.721G>A p.Gly241Arg G241R exon 6 G to A at 853 Gly to Arg at 241
c.727A>C p.Met243Leu M243L exon 6 A to C at 859 Met to Leu at 243 (ATG to CTG)
c.727A>G p.Met243Val
c.731T>A p.Met244Lys M244K exon 6 T to A at 863 Met to Lys at 244
c.738G>A p.Lys246Lys
c.741C>T 873C/T exon 6 C or T at 873 sequence variation
c.741C>G p.Tyr247X Y247X exon 6 C to G at 873 Tyr to Stop at 247
c.742_743insTACA p.Arg248IlefsX? 874Ins TACA exon 6 Insertion of 4 bp (TACA) at 874 stop codon at amino acid 257 in exon 6b
c.743G>C p.Arg248Thr R248T exon 6 G to C at 875 Arg to Thr at 248 (CBAVD)
c.-318_-314delAGGGA promoter
c.769G>A p.Glu257Lys E257K exon 7 901G>A
c.772A>G p.Arg258Gly R258G exon 7 A to G at 904 Arg to Gly at 258
c.773delG p.Arg258AsnfsX3 905delG exon 7 deletion of G at 905 frameshift
c.775delinsTCTTCCTCAGATTCATTGTGATTACCTCA p.Leu259SerfsX7 exon 7




Comments or questions? Please email to cftr.admin
The Database was last updated at Apr 25, 2011