BASIC TEXT SEARCH Select your search field from the pull-down menu, enter your search term in the adjacent window and click the "Submit Query" button. The "Mutation Names" search will look for a match in cDNA, protein, or legacy name. You can also search all fields by selecting "All Fields". For advanced search click on the "Advanced Search" button below.

Search:


SEARCH TIPS
  • Search is case insensitive.
  • Search term can consist of a whole word or part of a word e.g.
    • Searching for "551" in the Protein Name field will retrieve all mutations that alter the protein at position 551.
    • Searching for "del" in Mutation Names will retrieve all deletion mutations (but it may take awhile).


cDNA Name Protein Name Legacy Name Region Description Consequence
c.(?_744)_(2988_?)dup exon 7 - exon 18 Duplication of exons 6B to 16
c.-9_14del23 124del23bp promoter delete 23 bp from 124 to 146 5UTR-exon1 mutation
c.-165G>A - 33G- >A promoter G to A at - 33 promoter mutation
c.-226G>T - 94G- >T promoter G to T at - 94 promoter mutation
c.-8G>C 125G/C promoter G or C at 125 sequence variation
c.-93G>C 40G/C promoter G to C at 40 Sequence variation
c.-495C>T - 363C/T promoter C to T at - 363 promoter mutation
c.-461A>G - 329A/G promoter A or G at - 329 upstream of the cap site promoter mutation
c.-593A>G - 461A- >G promoter A to G at - 461 promoter mutation
c.-34C>T 99C/T promoter C or T at 99 5UTR mutation
c.1A>G p.Met1Val M1V exon 1 A to G at 133 no translation initiation
c.1A>C p.Met1Leu M1L exon 1 A to C at 133 Met to Leu at 1
c.-26G>A 107 G/A promoter G to A at 107 sequence variation
c.-603_-601delAAG - 471delAGG promoter deletion of AGG from - 471 promoter mutation
c.-234T>A - 102T- >A promoter T to A at - 102 promoter mutation
c.-721G>A - 589G/A promoter G or A at - 589 sequence variation
c.-85C>G 48C/G promoter C or G at 48 5UTR mutation
c.-887_- 885delCTC - 816delCTC promoter deletion of CTC at - 816 promoter mutation original mapping was incorrect
c.-869T[8_9] - 790T9/8 promoter 9T or 8T at - 790 promoter mutation original mapping was incorrect
c.-751a>G promoter
c.-887C>T - 816C- >T promoter C to T at - 816 promoter mutation original mapping was incorrect
c.-812T>G - 741T- >G promoter T to G at - 741 promoter mutation original mapping was incorrect
c.-484t>G promoter
c.-444g>A promoter
c.-966T>G - 834T/G promoter T or G at - 834 promoter mutation
c.-410g>C promoter
c.-427c>T promoter
c.-274c>A promoter
c.-737g>A promoter
c.-4G>C 129G/C promoter G or C at 129 sequence variation
c.-943a>G promoter
c.2T>A p.Met1Lys M1K exon 1 T to A at 134 no translation initiation
c.2T>C p.Met1Thr M1T exon 1 T to C at 134 Met to Thr at 1
c.2T>G p.Met1Arg exon 1
c.3_122del120ins300 135del120ins300 exon 1
c.3G>A p.Met1Ile M1I(ATA) exon 1 G to A at 135 no translation initiation
c.3G>T p.Met1Ile M1I(ATT) exon 1 G to T at 135 no translation initiation
c.4C>T p.Gln2X Q2X (together with R3W) exon 1 C to T at 136 and A to T at 139 Gln to Stop at codon 2 and Arg to Trp at codon 3
c.11C>A p.Ser4X S4X exon 1 C to A at 143 Ser to Stop at 4
c.14C>T p.Pro5Leu P5L exon 1 C to T at 146 Pro to Leu at 5
c.19G>T p.Glu7X E7X exon 1 G to T at 151 Glu to Stop at 7
c.24G>A 156G/A exon 1 G or A at 156 sequence variation
c.28A>C p.Ser10Arg S10R exon 1 A to C at 160 Ser to Arg at 10
c.31G>A p.Val11Ile 163G/A exon 1 G or A at 163 sequence variation
c.35_36insTATCA p.Ser13IlefsX14 exon 1
c.38C>T p.Ser13Phe S13F exon 1 C to T at 170 Ser to Phe at 13
c.40A>T p.Lys14X K14X exon 1 A to T at 172 Lys to Stop at 14
c.42delA p.Lys14AsnfsX11 174delA exon 1 deletion of A between 172- 174 frameshift
c.43_44insT p.Ser18GlnfsX27 175insT exon 1 insertion of T after 175 frameshift
c.43delC p.Leu15PhefsX10 175delC exon 1 deletion of C at 175 frameshift
c.44T>C p.Leu15Pro L15P exon 1 T to C at 176 Leu to Pro at 15
c.49_50dupTT p.Trp19AlafsX7 exon 1
c.50delT p.Phe17SerfsX8 182delT exon 1 deletion of T at 182 frameshift
c.52A>G p.Ser18Gly S18G exon 1 A to G at 184 Ser to Gly at 18
c.53+1G>T 185+ 1G- >T intron 1 G to T at 185+ 1 mRNA splicing defect
c.53+4A>T 185+ 4A- >T intron 1 A to T at 185+ 4 mRNA splicing defect? (CBAVD)
c.53+45A>G 185+ 45A- >G intron 1 A to G at 185+ 45 sequence variation
c.53+178t>C intron 1
c.53+324a>G intron 1
c.54-13C>G 186- 13C- >G intron 1 C to G at 186- 13 mRNA splicing defect?
c.54-1161_164+1603del2875 CFTR- dele2 intron 1 186- 1161_296+ 1603del2875 Large in frame deletion removing exon2
c.54-2a>G intron 1
c.54-4235_164+377dup4723 intron 1
c.54-1G>A intron 1
c.57G>T p.Trp19Cys W19C exon 2 G to T at 189 Trp to Cys at 19
c.57G>A p.Trp19X W19X exon 2 G to A at 189 Trp to Stop at 19
c.72G>C p.Leu24Phe L24F exon 2 G to C at 204 Leu to Phe at 24
c.76A>G p.Lys26Glu exon 3
c.79G>A p.Gly27Arg G27R exon 2 G to A at 211 Gly to Arg at 27
c.79G>C p.Gly27Arg G27R(211G to C) exon 2 G to C at 211 Gly to Arg at 27
c.79G>T p.Gly27X G27X exon 2 G to T at 211 Gly to Stop at 27
c.80delG p.Gly27AspfsX64 211delG exon 2 deletion of G at 211 frameshift
c.80G>A p.Gly27Glu G27E exon 2 G to A at 212 Gly to Glu at 27
c.88C>T p.Gln30X Q30X exon 2 C to T at 220 Gln to Stop at 30
c.91C>T p.Arg31Cys 223C/T exon 2 C or T at 223 sequence variation
c.91C>T p.Arg31Cys R31C exon 2 C to T at 223 Arg to Cys at 31
c.92G>T p.Arg31Leu R31L exon 2 G to T at 224 Arg to Leu at 31
c.95T>C p.Leu32Pro exon 2
c.100_117delTTGTCAGACATATACCAA p.Leu34_Gln39del 232del18 exon 2 Deletion of 18 bp from 232 Deletion of 6 aa from Leu34 to Gln39
c.105_106insA p.Asp36ArgfsX9 237insA exon 2 insertion of A after 237 frameshift
c.106G>A p.Asp36Asn D36N exon 2 G to A at 238 Asp to Asn at 36
c.109A>G p.Ile37Val exon 2
c.111_112delAT p.Tyr38ProfsX6 241delAT exon 2 deletion of AT from 241 frameshift
c.112_113delTA p.Tyr38ProfsX6 244delTA exon 2 deletion of TA from 244 frameshift
c.114C>G p.Tyr38X Y38X exon 2 C to G at 246
c.115C>T p.Gln39X Q39X exon 2 C to T at 247 Gln to Stop at 39
c.125C>T p.Ser42Phe S42F exon 2 C to T at 257 Ser to Phe at 42
c.131A>T p.Asp44Val 263A/T exon 2 A or T at 263 sequence variation
c.131A>G p.Asp44Gly D44G exon 2 A to G at 263 Asp to Gly at 44
c.137C>A p.Ala46Asp A46D exon 2 C to A at 269 Ala to Asp at 46
c.137C>T p.Ala46Val A46V exon 2 C to T at 269
c.137C>A p.Ala46Asp A46D exon 2 C to A at 269 Ala to Asp at 46
c.137C>T p.Ala46Val A46V exon 2 C to T at 269
c.147A>G 279A/G exon 2 A to G at 279 No change (Leu at 49)
c.148T>C p.Ser50Pro S50P exon 2 T to C at 280 Ser to Pro at 50
c.149C>A p.Ser50Tyr S50Y exon 2 C to A at 281 Ser to Tyr at 50 (CBAVD)
c.156delA p.Lys52AsnfsX39 284delA exon 2 deletion of A at 284 frameshift
c.163_164ins8 p.Arg55AsnfsX39 295ins8 exon 2 insertion of ATTGGAAA after 295 frameshift
c.164+1G>A 296+ 1G- >A intron 2 G to A at 296+ 1 splicing
c.164G>A p.Arg55Lys R55K exon 2 G to A at 296 Arg to Lys at 55
c.164+1G>C 296+ 1G- >C intron 2 G to C at 296+ 1 mRNA splicing defect
c.164+28A>G 296+ 28A- >G intron 2 A to G at 296+ 28 mRNA splicing
c.164+2T>A 296+ 2T- >A intron 2 T to A at 296+ 2 mRNA splicing Defect
c.164+2T>C 296+ 2T- >C intron 2 T to C at 296+ 2 mRNA splicing defect
c.164+2T>G 296+ 2T- >G intron 2 T to G at 296 + 2 mRNA splicing defect
c.164+12T>C 296+ 12T- >C intron 2 T to C at 296+ 12 mRNA splicing defect?
c.164+1G>T 296+ 1G- >T intron 2 G to T at 296+ 1 missense; mRNA splicing defect?
c.164+9A>T 296+ 9A- >T intron 2 A to T at 296+ 9 mRNA splicing defect?
c.164+3_164+4insT 296+ 3insT intron 2 insertion of T after 296+ 3 mRNA splicing defect?
c.164+129G>C 296+ 128G/C intron 2 G or C at 296+ 128 sequence variation
c.164_263dupGAGAATGGGATAGAGAGCTGGCTTCAAAGAAAAATCCTAAACTCATTAATGCCCTTCGGCGATGTTTTTTCTGGAGATTTATGTTCTATGGAATCTTTTT p.Tyr89ArgfsX4 exon 2 - exon 3
c.165-3C>T 297- 3C- >T intron 2 C to T at 297- 3 mRNA splicing defect?
c.165-73A>G 297- 73 A/G intron 2 297 - 73 A>G sequence variation ?
c.165-27_65-28insA 297- 28insA intron 2 insertion of A after 297- 28 mRNA splicing defect?
c.165-3C>A 297- 3C- >A intron 2 C to A at 297- 3 mRNA splicing defect?
c.165-12_165-11insA 297- 12insA intron 2 insertion of A at 297- 12 splice mutation?
c.165-45A>G 297- 45 A- >G intron 2 A to G at 297- 45 Sequence variation
c.165-67A>C 297- 67A/C intron 2 A or C at 297- 67 sequence variation
c.165-10T>G 297- 10T- >G intron 2 T to G at 297- 10 splice mutation?
c.165-2A>G 297- 2A- >G intron 2 A to G at 297- 2 mRNA splicing defect
c.165-50A>G 297- 50A/G intron 2 A or G at 297- 50 sequence variation?
c.165-55C>T 297- 55C/T intron 2 C to T at 297- 55 sequence variation
c.165-57G>T 297- 57 G/T intron 2 297 - 57 G>T sequence variation ?
c.165-1g>A intron 2
c.166G>A p.Glu56Lys E56K exon 3 G to A at 298 Glu to Lys at 56
c.168delA p.Glu56AspfsX35 300delA exon 3 deletion of A at 300 frameshift
c.169T>C p.Trp57Arg W57R exon 3 T to C at 301 Trp to Arg at 57
c.169T>G p.Trp57Gly W57G exon 3 T to G at 301 Trp to Gly at 57
c.170G>A p.Trp57X W57X(TAG) exon 3 G to A at 302 Trp to Stop at 57
c.171G>A p.Trp57X W57X(TGA) exon 3 G to A at 303 Trp to Stop at 57
c.172G>A p.Asp58Asn D58N exon 3 G to A at 304 Asp to Asn at 58
c.173A>G p.Asp58Gly D58G exon 3 A to G at 305 Asp to Gly at 58
c.174_175insA p.Arg59LysfsX10 306insA exon 3 insertion of A at 306 frameshift
c.174_177delTAGA p.Asp58GlufsX32 306delTAGA exon 3 deletion of TAGA from 306 frameshift
c.178G>A p.Glu60Lys E60K exon 3 G to A at 310 Glu to Lys at 60
c.178G>T p.Glu60X E60X exon 3 G to T at 310 Glu to Stop at 60
c.182T>C p.Leu61Pro L61P exon 3 T to C at 314 Leucine to Proline at position 61
c.190A>G p.Lys64Glu K64E exon 3 A to G at 322 Lys tu Glu at 64
c.197A>G p.Asn66Ser N66S exon 3 A to G at 329 Asn to Ser at 66
c.200C>T p.Pro67Leu P67L exon 3 C to T at 332 Pro to Leu at 67
c.202A>G p.Lys68Glu K68E exon 3 A to G at 334 Lys to Glu at 68
c.204A>T p.Lys68Asn K68N exon 3 A to T at 336 Lys to Asn at 68
c.206T>G p.Leu69Arg exon 3
c.213T>C 345T/C exon 3 T or C at 345 sequence variation
c.214G>A p.Ala72Thr A72T exon 3 G to A at 346 Ala to Thr at 72
c.215C>A p.Ala72Asp A72D exon 3 C to A at 347 Ala to Asp at 72
c.217delC p.Leu73PhefsX18 347delC exon 3 deletion of C at 347 frameshift
c.220C>T p.Arg74Trp R74W exon 3 C to T at 352 Arg to Trp at 74
c.221G>A p.Arg74Gln R74Q exon 3 G to A at 353 Arg to Gln at 74
c.223C>T p.Arg75X R75X exon 3 C to T at 355 Arg to Stop at 75
c.224G>A p.Arg75Gln R75Q exon 3 G or A at 356 sequence variation
c.224G>T p.Arg75Leu R75L exon 3 G to T at 356 Arg to Leu at 75
c.224G>A p.Arg75Gln R75Q exon 3 G or A at 356 sequence variation
c.227_228insT p.Trp79LeufsX32 359insT exon 3 insertion of T after 359 frameshift
c.228T>G p.Cys76Trp exon 3
c.233_234insT p.Trp79LeufsX32 365- 366insT (W79fs) exon 3 insertion at 360 - 365 Frameshift (W79fs)
c.233delT p.Phe78SerfsX13 360delT exon 3 deletion of T at 360 frameshift
c.228_229insT p.Trp79LeufsX32 360- 365insT exon 3 Insertion of T at 360- 365 Frameshift
c.234delC p.Trp79GlyfsX12 exon 3
c.235T>C p.Trp79Arg W79R exon 3 T to C at 367 Trp to Arg at 79
c.236G>A p.Trp79X W79X exon 3 G to A at 368 Trp to Stop at 79
c.244A>G p.Met82Val M82V exon 3 A to G at 376 Met to Val at 82
c.247_248insT p.Tyr84LeufsX27 379- 381insT exon 3 Insertion of T at 379- 381 Frameshift
c.250T>C p.Tyr84His Y84H exon 3 T to C at 382 Tyr to His at 84
c.254G>T p.Gly85Val G85V exon 3 G to T at 386 Gly to Val at 85
c.254G>A p.Gly85Glu G85E exon 3 G to A at 386 Gly to Glu at 85
c.259T>C p.Phe87Leu F87L exon 3 T to C at 391 Phe to Leu at 87
c.259T>A p.Phe87Ile exon 3
c.260T>C p.Phe87Ser F87S exon 3 392T>C
c.262_263delTT p.Leu88IlefsX22 394delTT exon 3 deletion of TT from 394 frameshift
c.263T>C p.Leu88Ser L88S exon 3 T to C at 395 Leu to Ser at 88
c.263T>G p.Leu88X L88X(T- >G) exon 3 T to G at 395 Leu to Stop at 88
c.263T>A p.Leu88X L88X(T- >A) exon 3 T to A at 395 Leu to Stop at 88
c.264_268delATATT p.Leu88PhefsX21 exon 3
c.266A>G p.Tyr89Cys Y89C exon 3 A to G at 398 Tyr to Cys at 89
c.269T>C p.Leu90Ser L90S exon 3 T to C at 401 Leu to Ser at 90
c.269T>C p.Leu90Ser L90S exon 3 T to C at 401 Leu to Ser at 90
c.271G>A p.Gly91Arg G91R exon 3 G to A at 403 Gly to Arg at 91
c.273+1G>A 405+ 1G- >A intron 3 G to A at 405+ 1 mRNA splicing defect
c.273+3A>C 405+ 3A- >C intron 3 A to C at 405+ 3 mRNA splicing defect?
c.273+42A>G 405+ 42A/G intron 3 A or G at 405+ 42 sequence variation
c.273+4A>G 405+ 4A- >G intron 3 A to G at 405+ 4 mRNA splicing defect?
c.273+46T>G 405+ 46G/T intron 3 G or T at 405+ 46 sequence variation
c.273+10247C>T 405+ 10247C>T intron 3 405+ 10247C>T
c.273+10255delC 405+ 10255delC intron 3 405+ 10255delC
c.274-1G>C 406- 1G- >C intron 3 G to C at 406- 1 mRNA splicing defect
c.274-3T>C 406- 3T- >C intron 3 T to C at 406- 3 mRNA splicing defect?
c.274-10C>G 406- 10C- >G intron 3 C to G at 406- 10 mRNA splicing defect?
c.274-1G>T 406- 1G- >T intron 3 G to T at 406- 1 mRNA splicing defect
c.274-112T>A 406- 112T/A intron 3 T or A at 406- 112 sequence variation
c.274-2A>C 406- 2A- >C intron 3 A to C at 406- 2 mRNA splicing defect
c.274-2A>G 406- 2A- >G intron 3 A to G at 406- 2 mRNA splicing defect
c.274-82T>A 406- 82T/A intron 3 T or A at 406- 82 Sequence variation
c.274G>A p.Glu92Lys E92K exon 4 G to A at 406 Glu to Lys at 92
c.274G>T p.Glu92X E92X exon 4 G to T at 406 Glu to Stop at 92
c.274-83A>G 406- 83A/G intron 3 A or G at 406- 83 sequence variation
c.274-1G>A 406- 1G- >A intron 3 G to A at 406- 1 mRNA splicing defect
c.274-13T>C 406- 13T/C intron 3 T or C at 406- 13 sequence variation
c.274-6T>C 406- 6T- >C intron 3 T to C at 406- 6 mRNA splicing defect?
c.274-5T>G 406- 5T- >G intron 3 T to G at 406- 5 mRNA splicing defect
c.276A>T p.Glu92Asp E92D exon 4 A to T at 408(GAA- >GAT) Gly to Asp at 92
c.278T>A p.Val93Asp exon 4
c.280_286delACCAAAG p.Thr94GlnfsX11 412del7- >TA exon 4 deletion of ACCAAAG from 412 and insertion of TA frameshift
c.287C>A p.Ala96Glu A96E exon 4 C to A at 419 Ala to Glu at 96
c.292C>T p.Gln98X Q98X exon 4 C to T at 424 Gln to Stop at 98 (Pakistani specific?)
c.293A>G p.Gln98Arg Q98R exon 4 A to G at 425 Gln to Arg at 98
c.293A>C p.Gln98Pro Q98P exon 4 A to C at 425 Gln to Pro at 98
c.296C>T p.Pro99Leu P99L exon 4 C to T at 428 Pro to Leu at 99
c.302T>C p.Leu101Ser L101S exon 4 T to C at 434 Leu to Ser at 101
c.302T>G p.Leu101X L101X exon 4 T to G at 434 Leu to Stop at 101
c.303_304insA p.Leu102ThrfsX9 435insA exon 4 insertion of A after 435 frameshift
c.305T>G p.Leu102Arg L102R exon 4 T to G at 437 Leu to Arg at 102
c.305T>C p.Leu102Pro L102P exon 4 T to C at 437 Leu to Pro at 102
c.307G>T p.Gly103X G103X exon 4 G to T at 439 Gly to Stop at 103
c.310delA p.Arg104GlufsX3 441delA exon 4 deletion of A at 441 and T to A at 486 frameshift
c.313delA p.Ile105SerfsX2 444delA exon 4 deletion of A at 444 frameshift
c.314T>A p.Ile105Asn I105N exon 4 T to A at 446 Ile to Asn at 105
c.319_326delGCTTCCTA p.Ala107X 451del8 exon 4 deletion of GCTTCCTA from 451 frameshift
c.320C>G p.Ala107Gly A107G exon 4 C to G at 452 Ala to Gly at 107
c.323C>T p.Ser108Phe S108F exon 4 C to T at 455 Ser to Phe at 108
c.325T>A p.Tyr109Asn Y109N exon 4 T to A at 457 Tyr to Asn at 109
c.325_327delTATinsG p.Tyr109GlyfsX4 457TAT- >G exon 4 TAT to G at 457 frameshift
c.325T>C p.Tyr109His exon 4
c.326_327delAT p.Tyr109X 458delAT exon 4 deletion of AT at 458 frameshift
c.326A>G p.Tyr109Cys Y109C exon 4 A to G at 458 Tyr to Cys at 109
c.327T>A p.Tyr109X Y109X exon 4 T to A at 459 Tyr to Stop at 109
c.328G>A p.Asp110Asn D110N exon 4 G to A at 460 Asp to Asn at 110
c.328G>C p.Asp110His D110H exon 4 G to C at 460 Asp to His at 110
c.328G>T p.Asp110Tyr D110Y exon 4 G to T at 460 Asp to Tyr at 110
c.328delG p.Asp110ThrfsX14 460delG exon 4 deletion of G at 460 frameshift
c.330C>A p.Asp110Glu D110E exon 4 C to A at 462 Asp to Glu at 110
c.331C>G p.Pro111Ala P111A exon 4 C to G at 463 Pro to Ala at 111
c.332C>T p.Pro111Leu P111L exon 4 C to T at 464 Pro to Leu at 111
c.333G>A 465G/A exon 4 G or A at 465 sequence variation
c.338A>T p.Asn113Ile N113I exon 4 A to T at 470 Asn to Ile
c.340A>T p.Lys114X K114X exon 4 A to T at 472 Lys to Stop at 114
c.343_345del p.Glu115del [delta]E115 exon 4 3 bp deletion of 475- 477 deletion of Glu at 115
c.346G>C p.Glu116Gln E116Q exon 4 G to C at 478 Glu to Gln at 116
c.346G>A p.Glu116Lys E116K exon 4 G to A at 478 Glu to Lys at 116
c.349C>T p.Arg117Cys R117C exon 4 C to T at 481 Arg to Cys at 117
c.349C>G p.Arg117Gly R117G exon 4 C to G at 481 Arg to Gly at 117
c.350G>A p.Arg117His R117H exon 4 G to A at 482 Arg to His at 117
c.350G>C p.Arg117Pro R117P exon 4 G to C at 482 Arg to Pro at 117
c.350G>T p.Arg117Leu R117L exon 4 G to T at 482 Arg to Leu at 117
c.355A>G p.Ile119Val I119V exon 4 A to G at 487 Iso to Val at 119
c.357C>T 489 C/T exon 4 C to T at 489 sequence variation
c.357delC p.Ile119MetfsX5 489delC exon 4 deletion of C at 489 frameshift
c.358G>A p.Ala120Thr A120T exon 4 G to A at 490 Ala to Thr at 120
c.359C>T p.Ala120Val A120V exon 4 C to T at 491 Ala to Val at 120
c.360G>A 492G/A exon 4 G or A at 492 sequence variation
c.364T>C p.Tyr122His Y122H exon 4 T to C at 496 Tyr to His at 122
c.365A>G p.Tyr122Cys Y122C exon 4 A to G at 497 Tyr to Cys at 122
c.366T>A p.Tyr122X Y122X exon 4 T to A at 498 Tyr to Stop at 122
c.370G>C p.Gly124Arg G124R exon 4 502G>C
c.374T>C p.Ile125Thr I125T exon 4 T to C at 506 Ile to Thr at 125
c.376G>A p.Gly126Ser exon 4
c.377G>A p.Gly126Asp G126D exon 4 G to A at 509 Gly to Asp at 126
c.379_381dupTTA p.Leu127dup L127dup exon 4 511_513dupTTA
c.380T>G p.Leu127X L127X exon 4 T to G at 512 Leu to Stop at 127
c.382T>C p.Cys128Arg exon 4
c.387delT p.Leu130SerfsX? 519delT exon 4 T deleted frameshift
c.388C>G p.Leu130Val L130V exon 4 C to G at 520 Leucine to Valine at 130
c.393delT p.Phe131LeufsX3 525delT exon 4 deletion of T at 525 frameshift
c.396T>G p.Ile132Met I132M exon 4 T to G at 528 Ile to Met at 132 (sequence variation?)
c.405_406dupAC p.Leu136HisfsX18 exon 4
c.409_412delCTCC p.Leu137TyrfsX15 541del4 exon 4 deletion of CTCC from 541 frameshift
c.409delC p.Leu137SerfsX16 541delC exon 4 deletion of C at 541 frameshift
c.410T>C p.Leu137Pro L137P exon 4 T to C at 542 Leu to Pro at 137 (sequence variation?)
c.410T>A p.Leu137His L137H exon 4 T to A at 542 Leu to His at 137
c.410T>G p.Leu137Arg L137R exon 4 T to G at 542 Leu to Arg at 137
c.412_413insACT p.Leu137_Leu138insThr L138ins exon 4 insertion of CTA, TAC or ACT at nucleotide 544, 545 or 546 insertion of leucine at 138
c.413T>C p.Leu138Pro 545T/C exon 4 T or C at 545 sequence variation
c.414_415insCTA p.Leu139X 546insCTA exon 4 insertion of CTA at 546 frameshift
c.415_416insTA p.His139LeufsX15 547insTA exon 4 insertion of TA after 547 frameshift
c.415_416insGA p.His139ArgfsX15 547insGA exon 4 insertion of GA between nucleotides 547 and 548 Frameshift; a premature stop codon appears 15 codons further.
c.416A>T p.His139Leu H139L exon 4 A to T at 548 His to Leu at 139
c.416A>G p.His139Arg H139R exon 4 A to G at 548 His to Arg at 139
c.417C>T 549C/T exon 4 C to T at 549 sequence variation (His at 139 no change)
c.418C>T p.Pro140Ser P140S exon 4 C to T at 550 Pro to Ser at 140
c.419C>T p.Pro140Leu P140L exon 4 C to T at 551 Pro to Leu at 140
c.420_421insA p.Ala141SerfsX18 552insA exon 4 insertion of A after 552 frameshift
c.422C>A p.Ala141Asp A141D exon 4 C to A at 554 Ala to Asp at 141
c.424delA p.Ile142PhefsX11 556delA exon 4 deletion of A at 556 frameshift
c.429delT p.Phe143LeufsX10 557delT exon 4 deletion of T at 557 frameshift
c.433delC p.Leu145PhefsX8 565delC exon 4 deletion of C at 565 frameshift
c.434T>A p.Leu145His L145H exon 4 T to A at 566 Leu to His at 145
c.437A>G p.His146Arg H146R exon 4 A to G at 569 His to Arg at 146 (CBAVD)
c.442A>T p.Ile148Phe exon 4
c.442delA p.Ile148LeufsX5 574delA exon 4 deletion of A at 574 frameshift
c.443T>A p.Ile148Asn I148N exon 4 T to A at 575 Ile to Asn at 148
c.443T>C p.Ile148Thr I148T exon 4 T to C at 575 Ile to Thr at 148
c.444_445InsCTA p.Leu149ins 576InsCTA exon 4 Insert CTA at 576 In frame in/del
c.445G>A p.Gly149Arg G149R exon 4 G to A at 577 Gly to Arg at 149
c.445G>T p.Gly149X exon 4
c.446G>T p.Gly149Val G149V exon 4 G to T at 578 Gly to Val at 149
c.451C>A p.Gln151Lys Q151K exon 4 C to A at 583 (CAG- >AAG) Gln to Lys at 151
c.451C>T p.Gln151X Q151X exon 4 C to T at 583 Gln to Stop at 151
c.454A>G p.Met152Val M152V exon 4 A to G at 586 Met to Val at 152 (mutation?)
c.454A>T p.Met152Leu M152L exon 4 A to T at 586 Met to Leu at 152
c.455T>G p.Met152Arg M152R exon 4 T to G at 587 Met to Arg at 152
c.459_476delAATAGCTATGTTTAGTTT p.Ala155_Ile160del 591del18 exon 4 deletion of 18 bp from 591 deletion of 6 a.a. from
c.463G>C p.Ala155Pro A155P exon 4 G to C at 595 Ala to Pro at 155
c.470T>A p.Phe157Tyr exon 4
c.472A>C p.Ser158Arg S158R exon 4 A to C at 604 Ser to Arg at 158
c.473G>A p.Ser158Asn S158N exon 4 G to A at 605 Ser to Asn at 158
c.473G>C p.Ser158Thr S158T exon 4 G to C at 605 Ser to Thr at 158
c.473G>A p.Ser158Asn exon 4
c.473_474insT p.Leu159PhefsX4 605insT exon 4 insertion of T after 605 frameshift
c.476T>A p.Leu159X L159X exon 4 T to A at 608 Leu to Stop at 159
c.476T>C p.Leu159Ser L159S exon 4 T to C at 608 Leu to Ser at 159
c.480T>A No Changes 612T/A exon 4 T or A at 612 (together with Y161S) sequence variation
c.481T>A p.Tyr161Asn Y161N exon 4 T to A at 613 Tyr to Asn at 161
c.481T>G p.Tyr161Asp Y161D exon 4 T to G at 613 Tyr to Asp at 161
c.482A>C p.Tyr161Ser Y161S exon 4 A to C at 614 (together with 612T/A) Tyr to Ser at 161
c.484A>G p.Lys162Glu K162E exon 4 A to G at 616 Lys to Glu at 162
c.488A>C p.Lys163Thr K163T exon 4 620A>C
c.489G>A 621G- >A exon 4 G to A at 621 mRNA splicing defect
c.489+1G>T 621+ 1G- >T intron 4 G to T at 621+ 1 mRNA splicing defect
c.489+2T>G 621+ 2T- >G intron 4 T to G at 621+ 2 mRNA splicing defect
c.489+31C>G 621+ 31C/G intron 4 C or G at 621+ 31 sequence variation
c.489+3A>G 621+ 3A- >G intron 4 A to G at 621+ 3 mRNA splicing defect
c.489+2T>C 621+ 2T- >C intron 4 T to C at 621+ 2 mRNA splicing defect
c.490-1G>A 622- 1G- >A intron 4 G to A at 622- 1 mRNA splicing defect
c.490-2A>C 622- 2A- >C intron 4 A to C at 622- 2 mRNA splicing defect
c.490-16T>C 622- 16 T/C intron 4 622 - 16 T>C sequence variation?
c.490-152G>C 622- 152G/C intron 4 G or C at 622- 152 sequence variation
c.490-103A>G 622- 103A/G intron 4 A or G at 622- 103 sequence variation
c.490-2A>G 622- 2A- >G intron 4 A to G at 622- 2 mRNA splicing defect
c.490-116A>G 622- 116A/G intron 4 A or G at 622- 116 sequence variation
c.490A>G p.Thr164Ala T164A exon 5 622A>G
c.494delT p.Leu165X 624delT exon 5 deletion of T at 624 frameshift
c.494T>C p.Leu165Ser L165S exon 5 T to C at 626 Leu to Ser at 165
c.496A>G p.Lys166Glu K166Q exon 5 A to G at 628 Lys to Gln at 166
c.500T>G p.Leu167Arg exon 5
c.508C>G p.Arg170Gly R170G exon 5 C to G at 640 Arg to Gly at 170
c.508C>T p.Arg170Cys R170C exon 5 C to T at 640 Arg to Cys at 170
c.509G>A p.Arg170His R170H exon 5 G to A at 641 Arg to His at 170
c.518_522delATAAA p.Ile175TyrfsX6 650delATAAA exon 5 Deletion of ATAAA at 650 Frameshift
c.523A>G p.Ile175Val I175V exon 5 A to G at 655 Ile to Val at 175
c.526delA p.Ser176ValfsX13 657delA exon 5 deletion of A at 657 frameshift
c.530T>C p.Ile177Thr I177T exon 5 T to C at 662 Ile to Thr at 177
c.531delT p.Ile177MetfsX12 663delT exon 5 deletion of T at 663 frameshift
c.531T>G p.Ile177Met I177M exon 5 663T>G
c.532G>A p.Gly178Arg G178R exon 5 G to A at 664 Gly to Arg at 178
c.533G>A p.Gly178Glu G178E exon 5 G to A at 665 Gly to Glu at 178
c.535C>A p.Gln179Lys Q179K exon 5 C to A at 667 Gln to Lys at 179
c.543_546delTAGT p.Leu183PhefsX5 675del4 exon 5 deletion of TAGT from 675 frameshift
c.544A>G p.Ser182Gly 676A/G exon 5 A or G at 676 sequence variation
c.547C>A p.Leu183Ile L183I exon 5 C to A at 679 Leu to Ile at 183
c.550delC p.Leu184PhefsX5 681delC exon 5 deletion of C at 681 frameshift
c.558C>A p.Asn186Lys N186K exon 5 C to A at 690 Asn to Lys at 186
c.561C>A p.Asn187Lys N187K exon 5 C to A at 693 Asn to Lys at 187
c.566A>G p.Asn189Ser N189S exon 5 A to G at 698 Asn to Ser at 189
c.567C>A p.Asn189Lys N189K exon 5 C to A at 699 Asn to Lys at 189
c.574_576delGAT p.Asp192del [delta]D192 exon 5 deletion of TGA or GAT from 706 or 707 deletion of Asp at 192
c.574G>A p.Asp192Asn D192N exon 5 G to A at 706 Asp to Asn at 192
c.575A>G p.Asp192Gly D192G exon 5 A to G at 707 Asp to Gly at 192
c.577G>A p.Glu193Lys E193K exon 5 G to A at 709 Glu to Lys at 193
c.577G>T p.Glu193X E193X exon 5 G to T at 709 Glu to Stop at 193
c.578_579+5delAAGTATG p.Glu193ValfsX20 710_711+ 5del7 exon 5 Deletion of AAGTATG between 710 and 711+ 5
c.579+1G>T 711+ 1G- >T intron 5 G to T at 711+ 1 mRNA splicing defect
c.579+34A>G 711+ 34A- >G intron 5 A to G at 711+ 34 mRNA splicing defect?
c.579+3A>G 711+ 3A- >G intron 5 A to G at 711+ 3 mRNA splicing defect
c.579+3A>T 711+ 3A- >T intron 5 A to T at 711+ 3 mRNA splicing defect?
c.579+5G>A 711+ 5G- >A intron 5 G to A at 711+ 5 mRNA splicing defect
c.579+3A>C 711+ 3A- >C intron 5 A to C at 711+ 3 mRNA splicing defect
c.580-1G>T 712- 1G- >T intron 5 G to T at 712- 1 mRNA splicing defect
c.580-92T>A 712- 92T/A intron 5 T or A at 712- 92 sequence variation
c.580G>A p.Gly194Arg G194R exon 6 G to A at 712 Gly to Arg at 194
c.581G>T p.Gly194Val G194V exon 6 G to T at 713 Gly to Val at 194
c.592G>C p.Ala198Pro A198P exon 6 G to C at 724 Ala to Pro at 198
c.592G>A p.Ala198Thr A198T exon 6 G to A at 724
c.595C>T p.His199Tyr H199Y exon 6 C to T at 727 His to Tyr at 199
c.596A>G p.His199Arg H199R exon 6 A to G at 728 His to Arg at 199
c.597T>G p.His199Gln H199Q exon 6 T to G at 729 His to Gln at 199
c.598T>A p.Phe200Ile F200I exon 6 T to A at 730 Phe to Ile at 200
c.601G>A p.Val201Met V201M exon 6 G to A at 733 Val to Met at 201
c.601delG p.Val201CysfsX14 733delG exon 6 Deletion of G at 733 Frameshift
c.606G>A p.Trp202X W202X exon 6 G to A at 738 Try to Stop at 202
c.609C>T 741C/T exon 6 C or T at 741 sequence variation
c.609C>G p.Ile203Met I203M exon 6 C to G at 741 Ile to Met at 203
c.613C>T p.Pro205Ser P205S exon 6 C to T at 745 Pro to Ser at 205
c.614C>G p.Pro205Arg P205R exon 6 C to G at 746 Pro to Arg at 205
c.614C>T p.Pro205Leu exon 6
c.617T>G p.Leu206Trp L206W exon 6 T to G at 749 Leu to Trp at 206
c.618G>T p.Leu206Phe L206F exon 6 G to T at 750 Leu to Phe at 206
c.619C>T p.Gln207X Q207X exon 6 C to T at 751 Gln to Stop at 207
c.625G>T p.Ala209Ser A209S exon 6 G to T at 757 Ala to Ser at 209
c.627A>G 759A/G (A209A)) exon 6 A or G at 759 sequence variation (Ala at 209 no change)
c.629T>C p.Leu210Pro L210P exon 6 T to C at 761 Leu to Pro at 210
c.639G>T G213V exon 6 G to T at 771 Gly to Val at 213
c.647G>A p.Trp216X W216X exon 6 G to A at 779 Trp to Stop at 216
c.648G>T p.Trp216Cys W216C exon 6 G to T at 780 Trp to Cys at 216
c.650A>G p.Glu217Gly E217G exon 6 A to G at 782 Glu to Gly at 217
c.650_659delAGTTGTTACA p.Glu217GlyfsX11 exon 6
c.653T>A p.Leu218X L218X exon 6 T to A at 785 Leu to Stop at 218
c.658C>T p.Gln220X Q220X exon 6 C to T at 790 Gln to Stop at 220
c.659A>G p.Gln220Arg Q220R exon 6 A to G at 791 Gln to Arg at 220
c.663G>A 795G/A exon 6 G to A at 795 Sequence variation. No change
c.673T>C p.Cys225Arg C225R exon 6 T to C at 805 Cys to Arg at 225
c.675T>A p.Cys225X C225X exon 6 T to A at 807 Cys to Stop at 225
c.680T>G p.Leu227Arg L227R exon 6 T to G at 812 Leu to Arg at 227
c.695T>A p.Val232Asp V232D exon 6 T to A at 827 Val to Asp at 232 (CBAVD)
c.697C>T p.Leu233Phe L233F exon 6 829C>T
c.701C>A p.Ala234Asp exon 6
c.708delT p.Gln237ArgfsX4 exon 6
c.709C>G p.Gln237Glu Q237E exon 6 C to G at 841 Gln to Glu at 237
c.711G>C p.Gln237His Q237H exon 6 843G>C
c.713C>T p.Ala238Val A238V exon 6 C to T at 845 Ala to Val at 238
c.714delT p.Leu240X exon 6
c.715G>A p.Gly239Arg G239R exon 6 G to A at 847 Gly to Arg at 239
c.720_741delAGGGAGAATGATGATGAAGTAC p.Gly241GlufsX13 852del22 exon 6 deletion of 22 bp from 852 frameshift
c.721G>A p.Gly241Arg G241R exon 6 G to A at 853 Gly to Arg at 241
c.727A>C p.Met243Leu M243L exon 6 A to C at 859 Met to Leu at 243 (ATG to CTG)
c.731T>A p.Met244Lys M244K exon 6 T to A at 863 Met to Lys at 244
c.741C>G p.Tyr247X Y247X exon 6 C to G at 873 Tyr to Stop at 247
c.741C>T 873C/T exon 6 C or T at 873 sequence variation
c.742_743insTACA p.Arg248IlefsX? 874Ins TACA exon 6 Insertion of 4 bp (TACA) at 874 stop codon at amino acid 257 in exon 6b
c.743G>C p.Arg248Thr R248T exon 6 G to C at 875 Arg to Thr at 248 (CBAVD)
c.743+1G>A 875+ 1G- >A intron 6 G to A at 875+ 1 mRNA splicing defect
c.743+40A>G 875+ 40A/G intron 6 A or G at 875+ 40 sequence variation
c.743+1G>C 875+ 1G- >C intron 6 G to C at 875+ 1 mRNA splicing defect
c.743+4G>T 875+ 4G>T intron 6 875+ 4G>T
c.744-14_744-3del 876- 14del12 intron 6 deletion of 12 bp from 876- 14 mRNA splicing defect?
c.744-10_744-3del 876- 10del8 intron 6 deletion of 8 bp from 876- 10 mRNA splicing defect?
c.744-3C>T 876- 3C- >T intron 6 C to T at 876- 3 splicing mutation?
c.744-2a>G intron 6
c.744-6_744-3delTTAC intron 6
c.744-8A>C 876- 8 A- >C intron 6 876 - 8 A>C mRNA splicing defect?
c.744-31TTGA(5_7) TTGA repeats intron 6 5- 7 copies of repeat at around 876- 31 sequence variation
c.-318_-314delAGGGA promoter
c.769G>A p.Glu257Lys E257K exon 7 901G>A
c.772A>G p.Arg258Gly R258G exon 7 A to G at 904 Arg to Gly at 258
c.773delG p.Arg258AsnfsX3 905delG exon 7 deletion of G at 905 frameshift
c.775delinsTCTTCCTCAGATTCATTGTGATTACCTCA p.Leu259SerfsX7 exon 7
c.794T>G p.Met265Arg M265R exon 7 T to G at 926 Met to Arg at 265
c.803delA p.Asn268IlefsX17 935delA exon 7 deletion of A at 935 frameshift
c.805_806delAT p.Ile269ProfsX4 936delTA exon 7 deletion of TA from 936 frameshift
c.825C>G p.Tyr275X exon 7
c.828C>A p.Cys276X C276X exon 7 C to A at 960 Cys to Stop at 276
c.829T>A p.Trp277Arg W277R exon 7 T to A at 961 Trp to Arg at 277
c.836_838delAAG p.Glu279del E278del exon 7 deletion of AAG from 965 deletion of Glu at 278
c.-236a>T promoter
c.837A>T p.Glu279Asp E279D exon 7 A to T at 969 Glu to Asp at 279
c.837A>T p.Glu279Asp E279D exon 7 A to T at 969 Glu to Asp at 279
c.842T>C p.Met281Thr M281T exon 7 T to C at 974 Met to Thr at 281
c.845_846insA p.Met284AsnfsX3 977insA exon 7 insertion of A after 977 frameshift
c.846A>T p.Glu282Asp E282D exon 7 978A>T
c.853A>T p.Ile285Phe I285F exon 7 A to T at 985 Ile to Phe at 285
c.853A>T p.Ile285Phe I285F exon 7 A to T at 985 Ile to Phe at 285
c.857_858insA p.Asn287LysfsX21 989- 992insA exon 7 Insertion of A at 989- 992 Frameshift
c.859A>T p.Asn287Tyr N287Y exon 7 A to T at 991 Asn to Tyr at 287
c.859_863delAACTT p.Asn287LysfsX19 991del5 exon 7 deletion AACTT from 991 or CTTAA from 993 frameshift
c.861C>G p.Asn287Lys exon 7
c.862_869+1delTTAAGACAG p.Leu288fsX? 994del9 exon 7 deletion of TTAAGACAG from 994 mRNA splicing defect
c.868C>T p.Gln290X Q290X exon 7 C to T at 1000 Gln to Stop at 290
c.869+3A>T 1001+ 3A>T intron 7 A to T at 1001+ 3 Alternative splicing and complete skipping of exon 6b
c.869+11C>T 1001+ 11C/T intron 7 C or T at 1001+ 11 sequence variation
c.869+12C>T 1001+ 12C/T intron 7 C or T at 1001+ 12 sequence variation
c.869+5g>A intron 7
c.869+4A>C;c.861_865delCTTAA p.Asn287LysfsX21 1001+ 4A- >C+ 993delCTTAA intron 7 splicing
c.870-7_870-5delTTT 1002- 7delTTT intron 7 Deletion of TTT beginning at 1002- 7 Interference with splicing?
c.870-56C>G 1002- 56C/G intron 7 C or G at 1002- 56 sequence variation
c.870-2A>G 1002- 2A>G intron 7 A to G at 1002- 2 mRNA splicing defect
c.870-3T>G 1002- 3T- >G intron 7 T to G at 1002- 3 mRNA splicing defect
c.870-7_870-5delTTT intron 7
c.874G>A p.Glu292Lys E292K exon 8 G to A at 1006 Glu to Lys at 292
c.877C>A p.Leu293Met L293M exon 8 C to A at 1009 Leu to Met at 293
c.881_882delAA p.Lys294ThrfsX13 1013delAA exon 8 deletion of AA from 1013 frameshift
c.889C>T p.Arg297Trp R297W exon 8 C to T at 1021 Arg to Trp at 297
c.890G>A p.Arg297Gln R297Q exon 8 G to A at 1022 Arg to Gln at 297
c.895G>A p.Ala299Thr A299T exon 8 G to A at 1027 Ala to Thr at 299
c.902A>G p.Tyr301Cys Y301C exon 8 A to G at 1034 Tyr to Cys at 301
c.912C>G p.Tyr304X Y304X exon 8 C to G at 1044 Tyr to Stop at 304
c.913T>G p.Phe305Val F305V exon 8 T to G at 1045 Phe 305 Val
c.915C>T 1047C/T exon 8 C or T at 1047 sequence variation
c.920G>A p.Ser307Asn S307N exon 8 G to A at 1052 Ser to Asn at 307
c.925G>A p.Ala309Thr A309T exon 8 G to A at 1057 Ala to Thr at 309
c.926C>T p.Ala309Val A309V exon 8 C to T at 1058 Ala to Val at 309
c.926C>G p.Ala309Gly A309G exon 8 C to G at 1058 Ala to Gly at 309
c.926C>A p.Ala309Asp A309D exon 8 C to A at 1058 Ala to Asp at 309
c.927delC p.Phe310SerfsX18 1058delC exon 8 deletion of C at 1058 frameshift
c.927C>G A309A (1059C/G) exon 8 C or G at 1059 sequence variation
c.933_935delCTT p.Phe312del [delta]F311 exon 8 deletion of 3 bp between 1059 and 1069 deletion of Phe310, 311 or 312
c.933C>G p.Phe311Leu F311L exon 8 C to G at 1065 Phe to Leu at 311
c.938C>A p.Ser313X S313X exon 8 C to A at 1070 Ser to Stop
c.940G>C p.Gly314Arg G314R exon 8 G to C at 1072 Gly to Arg at 314
c.941G>T p.Gly314Val G314V exon 8 G to T at 1073 Gly to Val at 314
c.941G>A p.Gly314Glu G314E exon 8 G to A at 1073 Gly to Glu at 314
c.948T>G p.Phe316Leu F316L exon 8 T to G at 1080 Phe to Leu at 316
c.948delT p.Phe316LeufsX12 1078delT exon 8 deletion of T at 1078 frameshift
c.950T>C p.Val317Ala V317A exon 8 T to C at 1082 Val to Ala at 317
c.950T>C p.Val317Ala V317A exon 8 T to C at 1082 Val to Ala at 317
c.954G>A 1086G/A exon 8 G or A at 1086 Sequence variation
c.955T>G p.Phe319Val exon 8
c.958T>G p.Leu320Val L320V exon 8 T to G at 1090 Leu to Val at 320 CAVD
c.959T>A p.Leu320X L320X exon 8 T to A at 1091 Leu to Stop at 320
c.960A>G 1092A/G exon 8 A or G at 1092 sequence variation
c.960A>T p.Leu320Phe L320F exon 8 A to T at 1092 Leu to Phe at 320
c.961T>C p.Ser321Pro S321P exon 8 T to C at 1093 Ser to Pro at 321
c.964G>A p.Val322Met V322M (1096(G/A)) exon 8 G or A at 1096 sequence variation
c.965T>C p.Val322Ala V322A exon 8 T to C at 1097 Val to Ala at 322 (mutation?)
c.966G>A 1098G/A exon 8 G or A at 1098 sequence variation (Val at 322 no change)
c.971C>T p.Pro324Leu P324L exon 8 C to T at 1103 Pro to Leu at 324
c.972C>G 1104(C/G) exon 8 C or G at 1104 sequence variation
c.974A>G p.Tyr325Cys exon 8
c.980T>G p.Leu327Arg L327R exon 8 T to G at 1112 Leu to Arg at 327
c.980delT p.Leu327GlnfsX42 1112delT exon 8 deletion of T at 1112 frameshift
c.987delA p.Gly330GlufsX39 1119delA exon 8 deletion of A at 1119 frameshift
c.988G>T p.Gly330X G330X exon 8 G to T at 1120 Gly to Stop at 330
c.992T>A p.Ile331Asn I331N exon 8 T to A at 1124 Ile to Asn at 331
c.997C>T p.Leu333Phe L333F exon 8 997C>T
c.1000C>T p.Arg334Trp R334W exon 8 C to T at 1132 Arg to Trp at 334
c.1001G>T p.Arg334Leu R334L exon 8 G to T at 1133 Arg to Leu at 334
c.1001G>A p.Arg334Gln R334Q exon 8 G to A at 1133 Arg to Gln at 334
c.1006_1007insG p.Ile336SerfsX28 1138insG exon 8 insertion of G after 1138 frameshift
c.1006A>C p.Ile336Leu exon 8
c.1007T>A p.Ile336Lys I336K exon 8 T to A at 1139 Ile to Lys at 336
c.1012A>G p.Thr338Ala T338A exon 8 A to G at 1144 Thr to Ala at 338
c.1013C>T p.Thr338Ile T338I exon 8 C to T at 1145 Thr to Ile at 338
c.1016_1018del p.Thr339del [delta]T339 exon 8 deletion of 3 bp between 1148 and 1150 deletion of Thr at 1140
c.1018delA p.Ile340SerfsX29 1150delA exon 8 deletion of A at 1150 frameshift
c.1018_1019insTC p.Phe342HisfsX28 1150insTC exon 8 Insertion of TC at 1150 Frameshift
c.1019T>A p.Ile340Asn I340N exon 8 T to A at 1151 Ile to Asn at 340
c.1008_1019dup12 p.Phe337_Ile340dup 1151ins12 exon 8 tandem duplication of 12 bp from position 1140 to position 1151 Insertion-duplication of 4 amino acids within the M6 domain (transmembrane domain)
c.1021T>C p.Ser341Pro S341P exon 8 T to C at 1153 Ser to Pro at 341
c.1022_1023insTC p.Phe342HisfsX28 1154insTC exon 8 insertion of TC after 1154 frameshift
c.1029delC p.Cys343X 1161delC exon 8 deletion of C at 1161 frameshift
c.1029_1030insG p.Ile344AspfsX20 1161insG exon 8 insertion of G after 1161 frameshift
c.1032T>A 1164 T/A exon 8 T to A at 1164 sequence variation
c.1036C>T p.Leu346Leu exon 8
c.1037T>C p.Leu346Pro L346P exon 8 T to C at 1169 Leu to Pro at 346
c.1039C>T p.Arg347Cys R347C exon 8 C to T at 1171 Arg to Cys at 347
c.1040G>A p.Arg347His R347H exon 8 G to A at 1172 Arg to His at 347
c.1040G>T p.Arg347Leu R347L exon 8 G to T at 1172 Arg to Leu at 347
c.1040G>C p.Arg347Pro R347P exon 8 G to C at 1172 Arg to Pro at 347
c.1042A>G p.Met348Val M348V exon 8 A to G at 1174 Met to Val at AS 348
c.1043T>A p.Met348Lys M348K exon 8 T to A at 1175 Met to Lys at 348
c.1043T>C p.Met348Thr M348T exon 8 T to C at 1175 Met to Thr at 348
c.1046C>T p.Ala349Val A349V exon 8 C to T at 1178 Ala to Val at 349
c.1052C>G p.Thr351Ser T351S exon 8 C or G at 1184 sequence variation
c.1052C>T p.Thr351Ile T351I exon 8 C to T at 1184 Thr to Ile at 351
c.1053_1054delTC p.Arg352AlafsX11 1185delTC exon 8 Deletion of TC at 1185 Frameshift
c.1054C>G p.Arg352Gly R352G exon 8 C to G at 1186 Arg to Gly at 352
c.1054C>T p.Arg352Trp R352W exon 8 C to T at 1186 Arg to Trp at 352
c.1055G>A p.Arg352Gln R352Q exon 8 G to A at 1187 Arg to Gln at 352
c.1055G>A p.Arg352Gln R352Q exon 8 G to A at 1187 Arg to Gln at 352
c.1057C>T p.Gln353X Q353X exon 8 C to T at 1189 Gln to Stop at 353
c.1059A>C p.Gln353His Q353H exon 8 A to C at 1191 Gln to His at 353
c.1063C>T p.Pro355Ser P355S exon 8 C to T at 1195 Pro to Ser at 355
c.1067G>C p.Trp356Ser W356S exon 8 G to C at 1199 Tryptophan to Serine at codon 356
c.1069delG p.Ala357LeufsX12 1199delG exon 8 deletion of G at 1199 frameshift
c.1068G>A p.Trp356X W356X exon 8 G to A at 1200 Trp to Stop at 356
c.[1075C>A;1079C>A] p.[Gln359Lys;Thr360Lys] Q359K/T360K exon 8 C to A at 1207 and C to A at 1211 Glu to Lys at 359 and Thr to Lys at 360
c.1076A>G p.Gln359Arg Q359R exon 8 A to G at 1208 Gln to Arg at 359
c.1079C>G p.Thr360Arg T360R exon 8 C to G at 1211 sequence variation? (Thr to Arg at 360)
c.1081T>C p.Trp361Arg W361R(T- >C) exon 8 T to C at 1213 Trp to Arg at 361
c.1081T>A p.Trp361Arg W361R(T- >A) exon 8 T to A at 1213 Trp to Arg at 361
c.1081delT p.Trp361GlyfsX8 1213delT exon 8 deletion of T at 1213 frameshift
c.1083delG p.Trp361CysfsX8 1215delG exon 8 deletion of G at 1215 frameshift
c.1086T>A p.Tyr362X exon 8
c.1086T>G p.Tyr362X exon 8
c.1093_1094delCT p.Leu365TrpfsX16 1221delCT exon 8 deletion of CT from 1221 frameshift
c.1089_1091delinsAAT p.Asp363_Ser364delinsGluIle exon 8
c.1090T>C p.Ser364Pro S364P exon 8 T to C at 1222 Ser to Pro at 364
c.1094T>C p.Leu365Pro L365P exon 8 T to C at 1226 Leu to Pro at 365
c.1101A>T 1233A/T exon 8 A or T at 1233 Sequence variation
c.1111_1112ins6 p.Lys370_Ile371insThrLys 1243ins6 exon 8 insertion of ACAAAA after 1243 insertion of Asp and Lys after Lys370
c.1116+1G>A 1248+ 1G- >A intron 8 G to A at 1248+ 1 mRNA splicing defect
c.1116+1G>C 1248+ 1G- >C intron 8 G to C at 1248+ 1 Splicing
c.1116+52T>C 1248+ 52T/C intron 8 T or C at 1248+ 52 sequence variation
c.1116+31A>C 1248+ 31 A/C intron 8 1248 + 31 A>C sequence variation ?
c.1116+17C>T 1248+ 17C- >T intron 8 C or T at 1248+ 17 sequence variation
c.1117-5A>G 1249- 5A- >G intron 8 A to G at 1249 mRNA splicing defect?
c.1117-31A>G 1249- 31A- >G intron 8 1249- 31 A>G mRNA splicing defect?
c.1117-27_1117-26delTA 1249- 27delTA intron 8 deletion of TA at 1249- 27 mRNA splicing defect?
c.1117-30_1117-29delTA 1249- 30delAT intron 8 deletion of AT from 1249- 30 mRNA splicing defect?
c.1117-82C>T 1249- 82C/T intron 8 C or T at 1249- 82 sequence variation
c.1117-1g>A intron 8
c.1117-18g>T intron 8
c.1119T>G p.Asp373Glu D373E exon 9 T to G at 1251 Asp to Glu a 373
c.1125A>C p.Leu375Phe L375F exon 9 A to C at 1257 Leu to Phe at 375 (CUAVD)
c.1127_1128insA p.Gln378AlafsX4 1259insA exon 9 insertion of A after 1259 frameshift
c.1133A>G p.Gln378Arg Q378R exon 9 A to G at 1265 Gln to Arg at 378
c.1135G>A p.Glu379Lys E379K exon 9 G to A at 1267 Glu to Lys at 379
c.1135G>T p.Glu379X E379X exon 9 G to T at 1267 Glu to Stop at 379
c.1148T>C p.Leu383Ser L383S exon 9 T to C at 1280 Leu to Ser at 383
c.1149G>A L383L (1281G/A) exon 9 G or A at 1281 sequence variation
c.1152delA p.Glu384AspfsX4 1283delA exon 9 deletion of A at 1283 frameshift
c.1153_1154insAT p.Asn386IlefsX3 1288insTA exon 9 Insertion of TA at 1285 Or Insertion of AT at 1284 Frameshift
c.1157_1158insTA p.Leu387ThrfsX2 1289insTA exon 9 Insertion of TA at 1289 Frameshift
c.1159_1160delTT p.Leu387AsnfsX23 1291delTT exon 9 delete TT from 1291 Frame shift
c.1162_1168delACGACTA p.Thr388GlnfsX3 1294del7 exon 9 deletion of 7 bp from 1294 frameshift
c.1162_1163delACinsTA p.Thr388X T388X exon 9 AC to TA at 1294 Thr to Stop at 388
c.1163C>T p.Thr388Met T388M exon 9 C to T at 1295 Thr to Met at 388 (sequence variation?)
c.1164G>T 1296G/T exon 9 G to T at 1296 sequence variation (Thr at 388 no change)
c.1175T>C p.Val392Ala V392A exon 9 T to C at 1307 Val to Ala at 392 CAVD
c.1175T>G p.Val392Gly V392G exon 9 T to G at 1307 Val to Gly at 392
c.1177delG p.Val393X 1309delG exon 9 deletion of G at 1309 frameshift
c.1181T>G p.Met394Arg M394R exon 9 T to G at 1313 Met to Arg at 394
c.1186A>T p.Asn396Tyr N369Y exon 9 A to T at 1318 Asn to Tyr at 396
c.1191_1192insA p.Thr398AsnfsX13 1323insA exon 9 insertion of A after 1323 frameshift
c.1196C>T p.Ala399Val I1328T exon 9 T to C at 4115 Thr to Ile at 1328
c.1196C>A p.Ala399Asp A399D exon 9 C to A at 1328 Ala to Asp at 399
c.1196C>T p.Ala399Val A399V exon 9 C to T at 1328 Ala to Val at 399
c.1202G>A p.Trp401X W401X(TAG) exon 9 G to A at 1334 Trp to Stop at 401
c.1203G>A p.Trp401X W401X(TGA) exon 9 G to A at 1335 Trp to Stop at 401
c.1209G>C p.Glu403Asp E403D exon 9 G to C at 1341 Glu to Asp at 403
c.1209+1G>A 1341+ 1G- >A intron 9 G to A at 1341+ 1 mRNA splicing defect
c.1209+80G>A 1341+ 80G>A intron 9 G or A at 1341+ 80 unknown
c.1209+18A>C 1341+ 18A- >C intron 9 A to C at 1341+ 18 mRNA splicing defect?
c.1209+79C>T 1341+ 79 C/T intron 9 1341 + 79 C- >T sequence variation ?
c.1209G>A 1341G- >A exon 9 G to A at 1341 sequence variation
c.1209+6A>G 1341+ 6 A- >G intron 9 A to G at 1341+ 6 mRNA splicing defect?
c.1209+28C>T 1341+ 28C/T intron 9 C or T at 1341+ 28 sequence variation?
c.1210-2_1210-1delAG 1342- 2delAG intron 9 deletion of AG from 1342- 2 mRNA splicing defect
c.1210-2A>C 1342- 2A- >C intron 9 A to C at 1342- 2 mRNA splicing defect
c.1210-1delG 1342- 1delG intron 9 Deletion of G at 1342- 1 Frameshift
c.1210-1G>C 1342- 1G- >C intron 9 G to C at 1342- 1 mRNA splicing defect
c.1210-13G>T 1342- 13G/T intron 9 G or T at 1342- 13 sequence variation
c.1210-12T[5_9] poly- T tract variations intron 9 variable number (5T, 7T, 9T) of thymidines at the poly- T tract starting at position 1342- 6 sequence variation (3 variants of which IVS8-5T is affecting splicing of exon 9)
c.1210-11T>G 1342- 11TTT- >G intron 9 TTT to G at 1342- 11 mRNA splicing defect?
c.1242-310GT[8_13] 1342- 265(GT)n intron 9 variable number of copies at around 1342- 265 to - 310 sequence variation (greater than 8 alleles)
c.1242-35_1242-12GT[8_10] 1342- 12(GT)n intron 9 variable number of copies (8- 10x) at around 1342- 12 to - 35 sequence variation
c.1220A>T p.Glu407Val E407V exon 10 A to T at 1352 Glu to Val at 407
c.1220_1239delAATTATTTGAGAAAGCAAAA p.Glu407AlafsX4 exon 10
c.1227delT p.Phe409LeufsX33 exon 10
c.1234delG p.Ala412GlnfsX30 1366delG exon 10 deletion of G at 1366 frameshift
c.1240_1244delCAAAA p.Asn415X 1367del5 exon 10 deletion of CAAAA at 1367 frameshift
c.1235delC p.Ala412GlufsX30 1367delC exon 10 deletion of C at 1367 frameshift
c.1240C>T p.Gln414X Q414X exon 10 C to T at 1372 Gln to Stop at 414
c.1247A>G p.Asn416Ser N416S exon 10 A to G at 1379 Asn to Ser at 416
c.1253A>G p.Asn418Ser N418S exon 10 A to G at 1385 Asn to Ser at 418
c.1261A>G p.Thr421Ala exon 10
c.1270G>A p.Gly424Ser G424S exon 10 G to A at 1402 Gly to Ser at 424
c.1291A>G p.Ser431Gly S431G exon 10 A to G at 1423 Ser to Gly a 431
c.1301C>G p.Ser434X S434X exon 10 C to G at 1433 Ser to Stop at 434
c.1310G>T p.Gly437Val exon 10
c.1312A>G p.Thr438Ala exon 10
c.1315C>T p.Pro439Ser P439S exon 10 C to T at 1447 Pro to Ser at 439
c.1322T>C p.Leu441Pro exon 10
c.1324A>T p.Lys442X exon 10
c.1327G>T p.Asp443Tyr D443Y exon 10 G to T at 1459 Asp to Tyr at 443
c.1330_1331delAT p.Ile444X 1460delAT exon 10 deletion of AT from 1460 frameshift
c.1329T>C 1461 T/C exon 10 T to C at 1461 sequence variation
c.1329_1330insAGAT p.Ile444ArgfsX3 1461ins4 exon 10 insertion of AGAT after 1461 frameshift
c.1331T>C p.Ile444Thr I444T exon 10 T to C at 1463 lle to Thr at 444
c.1331T>G p.Ile444Ser I444S exon 10 T to G at 1463 Ile to Ser at 444
c.1340delA p.Lys447ArgfsX2 1471delA exon 10 deletion of A at 1471 frameshift
c.1343T>G p.Ile448Arg exon 10
c.1353_1354insT p.Gln452SerfsX30 exon 10
c.1355A>C p.Gln452Pro Q452P exon 10 A to C at 1487 Gln to Pro at 452
c.1359_1361delGTT p.Leu454del [delta]L453 exon 10 deletion of 3 bp between 1488 and 1494 deletion of Leu at 452 or 454
c.1364C>A p.Ala455Glu A455E exon 10 C to A at 1496 Ala to Glu at 455
c.1365_1366delGG p.Val456CysfsX25 1497delGG exon 10 deletion of GG at 1497 frameshift
c.1366G>T p.Val456Phe V456F exon 10 G to T at 1498 Val to Phe at 456
c.1367T>C p.Val456Ala V456A exon 10 T to C at 1499 Val to Ala at 456 (sequence variation?)
c.1373delG p.Gly458AspfsX11 1504delG exon 10 deletion of G at 1504 frameshift
c.1373delG p.Gly458AspfsX11 1504delG exon 10 deletion of G at 1504 frameshift
c.1373G>T p.Gly458Val G458V exon 10 G to T at 1505 Gly to Val at 458
c.1373G>T p.Gly458Val G458V exon 10 G to T at 1505 Gly to Val at 458
c.1388G>T p.Gly463Val exon 10
c.1388G>T p.Gly463Val G463V exon 10 G to T at 1520
c.1392G>T p.Lys464Asn K464N exon 10 G to T at 1524 Lys to Asn at 464, mRNA splicing defect?
c.1392+6_1392+7insA 1524+ 6insC intron 10 insertion of C after 1524+ 6, with G to A at 1524+ 12 mRNA splicing defect?
c.1392+68G>A 1524+ 68 G/A intron 10 1524 + 68 G>A sequence variation
c.1392+1G>A 1524+ 1G- >A intron 10 G to A at 1524+ 1 splice mutation
c.1392+4g>T intron 10
c.1392+60_1392+61insA 1524+ 60 insA exon 10 Ins A at 1524+ 60 sequence variation
c.1393-1G>A 1525- 1G- >A intron 10 G to A at 1525- 1 mRNA splicing defect
c.1393-18G>A 1525- 18G/A intron 10 G or A at 1525- 18 sequence variation or mRNA splicing defect?
c.1393-61A>G 1525- 61A/G intron 10 A or G at 1525- 61 sequence variation
c.1393-47T>G 1525- 47T- >G intron 10 1525- 47T>G Sequence Variation
c.1393-42G>A 1525- 42G>A intron 10 G or A at 1525- 42 unknown
c.1393-60G>A 1525- 60G/A intron 10 G or A at 1525- 60 sequence variation
c.1393-2A>G 1525- 2A- >G intron 10 A to G at 1525- 2 Splicing
c.1397C>G p.Ser466X S466X(TAG) exon 11 C to G at 1529 Ser to Stop at 466
c.1397C>T p.Ser466Leu S466L exon 11 C to T at 1529 Ser to Leu at 466 (CBAVD)
c.1397C>A p.Ser466X S466X(TAA) exon 11 C to A at 1529 Ser to Stop at 466
c.1399C>T p.Leu467Phe 1531C/T (L467F) exon 11 C or T at 1531 sequence variation
c.1403T>C p.Leu468Pro L468P exon 11 T to C at 1535 Leu to Pro at 468
c.1405A>G p.Met469Val M469V exon 11 A to G 1537 Met to Val at 469
c.1408A>G p.Met470Val M470V exon 11 A or G at 1540 sequence variation
c.1408_1417delATGATTATGG p.Met470GlufsX54 1540del10 exon 11 deletion of 10bp after 1540 frameshift
c.1418delG p.Gly473GlufsX54 1548delG exon 11 deletion of G from 1548 - 1550 frameshift
c.1420G>A p.Glu474Lys E474K exon 11 G to A at 1552 Glu to Lys at 474
c.1429C>T p.Pro477Ser exon 11
c.1433_1434delCA p.Ser478X 1565 del CA exon 11 deletion of CA from 1565 frameshift
c.1435G>T p.Glu479X E479X exon 11 G to T at 1567 Glu to Stop at 479
c.1438G>A p.Gly480Ser G480S exon 11 G to A at 1570 Gly to Ser at 480
c.1438G>T p.Gly480Cys G480C exon 11 G to T at 1570 Gly to Cys at 480
c.1439G>A p.Gly480Asp G480D exon 11 G to A at 1571 Gly to Asp at 480
c.1439delG p.Gly480ValfsX47 1571delG exon 11 deletion of G at 1571 frameshift
c.1440T>C 1572T/C exon 11 T or C at 1572 sequence variation
c.1444_1445insT p.Lys483X 1576insT exon 11 insertion of T at 1576 framshift
c.1450C>T p.His484Tyr H484Y exon 11 C to T at 1582 His to Tyr at 484 (CBAVD?)
c.1451A>G p.His484Arg H484R exon 11 A to G at 1583 His to Arg at 484
c.1453A>T p.Ser485Cys S485C exon 11 A to T at 1585 Ser to Cys at 485
c.1454G>C p.Ser485Thr S485T exon 11 G to C at 1586
c.1456G>T p.Gly486X G486X exon 11 G to T at 1588 Gly to Stop at 486
c.1466C>A p.Ser489X S489X exon 11 C to A at 1598 Ser to Stop at 489
c.1469_1470delTC p.Phe490LeufsX13 1601delTC exon 11 deletion of TC from 1601 or CT from 1602 frameshift
c.1469delT p.Phe490Serfs*37 exon 11
c.1471T>C p.Cys491Arg C491R exon 11 T to C at 1603 Cys to Arg at 491
c.1472G>C p.Cys491Ser exon 11
c.1475C>T p.Ser492Phe S492F exon 11 C to T at 1607 Ser to Phe at 492
c.1477C>T p.Gln493X Q493X exon 11 C to T at 1609 Gln to Stop at 493
c.1477_1478delCA p.Gln493ValfsX10 1609delCA exon 11 deletion of CA from 1609 frameshift
c.1478A>C p.Gln493Pro Q493P exon 11 A to C at 1610 Gln to Pro at 493
c.1478A>G p.Gln493Arg Q493R exon 11 A to G at 1610 Gln to Arg at 493
c.1482_1483delTT p.Ser495LeufsX8 1612delTT exon 11 deletion of TT from 1612 frameshift
c.1484C>A p.Ser495Tyr exon 11
c.1487G>A p.Trp496X W496X exon 11 G to A at 1619 Trp to Stop at 496
c.1489A>G p.Ile497Val I497V exon 11 A to G at 1621 Ile to Val at 497
c.1494G>C p.Met498Ile M498I exon 11 G to C at 1626 Met (ATG) to Ileu (ATC) at 498
c.1495C>G p.Pro499Ala P499A exon 11 C to G at 1627 Pro to Ala at 499 (CBAVD)
c.1501A>G p.Thr501Ala T501A exon 11 A to G at 1633 Thr to Ala at 501
c.1505T>C p.Ile502Thr I502T exon 11 T to C at 1637 Ile to Thr at 502
c.1505T>A p.Ile502Asn I502N exon 11 T to A at 1637 Ile to Asn at 502
c.1510G>T p.Glu504X E504X exon 11 G to T at 1642 Glu to Stop at 504
c.1510G>C p.Glu504Gln E504Q exon 11 G to C at 1642 Glu to Gln at 504
c.1519_1521delATC p.Ile507del [delta]I507 exon 11 deletion of 3 bp between 1648 and 1653 deletion of Ile506 or Ile507
c.1516A>G p.Ile506Val I506V (1648A/G) exon 11 A or G at 1648 Ile or Val at 506
c.1516A>C p.Ile506Leu I506L exon 11 A to C at 1648 Ile to Leu at 506
c.1517T>G p.Ile506Ser I506S exon 11 T to G at 1649 Ile to Ser at 506
c.1517T>C p.Ile506Thr I506T exon 11 T to C at 1649 Ile to Thr at 506
c.1518C>G p.Ile506Met 1650C/G exon 11 C to G at 1650 Ile to Met at 506; sequence variation
c.1519A>G p.Ile507Val 1651A/G exon 11 A or G at 1651 sequence variation
c.1521C>G p.Ile507Met exon 11
c.1521_1523delCTT p.Phe508del [delta]F508 exon 11 deletion of 3 bp between 1652 and 1655 deletion of Phe at 508
c.1521C>G p.Ile507Met exon 11
c.1521_1523delCTT p.Phe508del [delta]F508 exon 11 deletion of 3 bp between 1652 and 1655 deletion of Phe at 508
c.1523T>C p.Phe508Ser F508S exon 11 T to C at 1655 Phe to Ser at 508
c.1523T>G p.Phe508Cys F508C exon 11 T to G at 1655 Phe to Cys at 508
c.1528delG p.Val510PhefsX17 1660delG exon 11 Deletion of G at 1660 frameshift
c.1532C>G p.Ser511Cys exon 11
c.1538A>G p.Asp513Gly D513G exon 11 A to G at 1670 Asp to Gly at 513 (CBAVD)
c.1543T>C p.Tyr515His Y515H exon 11 T to C at 1675 Tyr to His at 515
c.1545_1546delTA p.Tyr515X 1677delTA exon 11 deletion of TA from 1677 frameshift
c.1546A>G p.Arg516Gly R516G exon 11 A to G at 1678 Arg to Gly at 516
c.1550A>G p.Tyr517Cys Y517C exon 11 A to G at 1682 Tyr to Cys at 517
c.1555A>G p.Ser519Gly S519G exon 11 A to G at 1687 Ser to Gly at 519
c.1558G>A p.Val520Ile V520I exon 11 G to A at 1690 Val to Ile at 520
c.1558G>T p.Val520Phe V520F exon 11 G to T at 1690 Val to Phe at 520
c.1561A>C p.Ile521Leu 1693A- >C exon 11 A to C at 1693 Ile to Leu at 521 (sequence variation?)
c.1561A>T p.Ile521Phe exon 11
c.1567G>T p.Ala523Ser exon 11
c.1572C>A p.Cys524X C524X exon 11 C to A at 1704 Cys to Stop at 524
c.1573C>T p.Gln525X Q525X exon 11 C to T at 1705 Gln to Stop at 525
c.1574_1590delAACTAGAAGAGGACATC p.Gln525LeufsX37 1706del17 exon 11 deletion of 17 bp from 1706 deletion of splice site
c.1579G>C p.Glu527Gln E527Q exon 11 G to C at 1711 Glu to Gln at 527
c.1580A>G p.Glu527Gly E527G exon 11 A to G at 1712 Glu to Gly at 527
c.1581A>G 1713A/G exon 11 A or G at 1713 sequence variation
c.1582G>A p.Glu528Lys E528K exon 11 G to A at 1714 Glu to Lys at 528
c.1584G>A 1716G/A exon 11 G or A at 1716 sequence variation
c.1584+2T>C 1716+ 2T- >C intron 11 T to C at 1716+ 2 mRNA splicing defect
c.1584G>T p.Glu528Asp E528D exon 11 G to T at 1716 Glu to Asp at 528 (splice mutation?)
c.1584+12T>C 1716+ 12T/C intron 11 T or C at 1716+ 12 sequence variation
c.1584+13G>T 1716+ 13G/T intron 11 G or T at 1716+ 13 sequence variation
c.1584+77A>G 1716+ 77A/G intron 11 A or G at 1716+ 77 sequence variation
c.1584+1G>T 1716+ 1G- >T intron 11 1716+ 1 G>T mRNA splicing defect
c.1584+4A>T 1716+ 4 A- >T intron 11 1716+ 4 A>T mRNA splicing defect
c.1584+1G>A 1716+ 1G- >A intron 11 G to A at 1716+ 1 mRNA splicing defect
c.1584+51_1584_61dup11 dup1716+ 51- >61 intron 11 duplication of 11 bp at 1716+ 51 sequence variation
c.1584+63A>C 1716+ 64A/C intron 11 A or C at 1716+ 64 sequence variation
c.1584+84C>T 1716+ 85C/T intron 11 C or T at 1716+ 85 sequence variation
c.1584+63_1584+64ins11 1716+ 63ins11nt intron 11 insertion of 11 nucleotides after 1716+ 63 sequence variation
c.1585G>C p.Asp529His D529H exon 12 G to C at 1717 Asp to His at 529
c.1585-1G>A 1717- 1G- >A intron 11 G to A at 1717- 1 mRNA splicing defect
c.1585-8G>A 1717- 8G- >A intron 11 G to A at 1717- 8 mRNA splicing defect?
c.1585-2A>G 1717- 2A- >G intron 11 A to G at 1717- 2 mRNA splicing defect
c.1585-3T>G 1717- 3T- >G intron 11 T to G at 1717- 3 mRNA splicing defect?
c.1585-19T>C 1717- 19T/C intron 11 T or C at 1717- 19 sequence variation
c.1585-9T>A 1717- 9T- >A intron 11 T to A at 1717- 9 mRNA splicing mutation?
c.1586A>G p.Asp529Gly D529G exon 12 A to G at 1718 Asp to Gly at 529
c.1588A>C p.Ile530Leu exon 12
c.1601C>A p.Ala534Glu A534E exon 12 C to A at 1733 Ala to Glu at 534
c.1606A>T p.Lys536X K536X exon 12 A to T at 1738 Lys to Stop codon at 536
c.1606A>G p.Lys536Glu K536E exon 12 A to G at 1738
c.1610_1611delAC p.Asp537GlufsX30 1742delAC exon 12 deletion of AC from 1742 frameshift
c.1611C>A p.Asp537Glu D537E exon 12 C to A or C to G at 1743 Asp to Glu at 537
c.1616T>C p.Ile539Thr I539T exon 12 T to C at 1748 Ile to Thr at 539
c.1617_1618insTA p.Val540X 1749insTA exon 12 insertion of TA at 1749 frameshift resulting in premature termination at 540
c.1622T>C p.Leu541Pro exon 12
c.1624G>T p.Gly542X G542X exon 12 G to T at 1756 Gly to Stop at 542
c.1625G>A p.Gly542Glu G542E exon 12 1757G>A
c.1630G>A p.Gly544Ser G544S exon 12 G to A at 1762 Gly to Ser at 544
c.1631G>T p.Gly544Val G544V exon 12 G to T at 1763 Gly to Val at 544 (CBAVD)
c.1632T>G 1764T/G exon 12 T or G at 1764 sequence variation
c.1635_1640del p.Ile546_Thr547del 1767del6 exon 12 delete 6 nucleotide from 1767 In frame in/del
c.1641A>T 1773A/T exon 12 A or T at 1773 sequence variation
c.1642_1643delCT p.Leu548GlufsX19 1774delCT exon 12 deletion of CT from 1774 frameshift
c.1643T>A p.Leu548Gln L548Q exon 12 T to A at 1775 Leu to Gln at 548
c.1645A>C p.Ser549Arg S549R(A- >C) exon 12 A to C at 1777 Ser to Arg at 549
c.1645_1648delAGTG p.Ser549GlufsX9 exon 12
c.1646G>A p.Ser549Asn S549N exon 12 G to A at 1778 Ser to Asn at 549
c.1646G>T p.Ser549Ile S549I exon 12 G to T at 1778 Ser to Ile at 549
c.1647T>G p.Ser549Arg S549R(T- >G) exon 12 T to G at 1779 Ser to Arg at 549
c.1648G>A p.Gly550Arg G550R exon 12 G to A at 1780 Gly to Arg at 550
c.1648G>T p.Gly550X G550X exon 12 G to T at 1780 Gly to Stop at 550
c.1650delA p.Gly551ValfsX8 1782delA exon 12 deletion of A at 1782 frameshift
c.1651G>A p.Gly551Ser G551S exon 12 G to A at 1783 Gly to Ser at 551
c.1652G>A p.Gly551Asp G551D exon 12 G to A at 1784 Gly to Asp at 551
c.1652delG p.Gly551ValfsX8 1784delG exon 12 deletion of G at 1784 frameshift
c.1654C>A p.Gln552Lys Q552K exon 12 C to A at 1786 Gln to Lys at 552
c.1654C>T p.Gln552X Q552X exon 12 C to T at 1786 Gln to Stop at 552
c.1656delA p.Gln552HisfsX7 1787delA exon 12 deletion of A at position 1787 or 1788 frameshift, stop codon at 558
c.1657C>G p.Arg553Gly R553G exon 12 C to G at 1789 Arg to Gly at 553
c.1657C>T p.Arg553X R553X exon 12 C to T at 1789 Arg to Stop at 553
c.1658G>A p.Arg553Gln R553Q exon 12 G to A at 1790 Arg to Gln at 553 (associated with [delta]F508;
c.1660_1661insA p.Ala554AspfsX14 exon 12
c.1663A>G p.Arg555Gly R555G exon 12 A to G at 1795 Arg to Gly at 555
c.1666A>G p.Ile556Val I556V exon 12 A to G at 1798 Ile to Val at 556 (mutation?)
c.1679+1643G>T 1811+ 1643G>T intron 12 1811+ 1643G>T
c.1670delC p.Ser557PhefsX2 1802delC exon 12 deletion of C at 1802 frameshift
c.1673T>C p.Leu558Ser L558S exon 12 T to C at 1805 Leu to Ser at 558
c.1674delA p.Ala559GlnfsX13 1806delA exon 12 deletion of A at 1806 frameshift
c.1675G>A p.Ala559Thr A559T exon 12 G to A at 1807 Ala to Thr at 559
c.1676C>A p.Ala559Glu A559E exon 12 C to A at 1808 Ala to Glu at 559
c.1676C>T p.Ala559Val A559V exon 12 C to T at 1808 Ala to Val at 559
c.1678A>G p.Arg560Gly R560G exon 12 A to G at 1810 Ala to Gly at 560
c.1679G>C p.Arg560Thr R560T exon 12 G to C at 1811 Arg to Thr at 560; mRNA splicing defect?
c.1679G>A p.Arg560Lys R560K exon 12 G to A at 1811 Arg to Lys at 560
c.1679+18G>A 1811+ 18G- >A intron 12 G to A at 1811+ 18 mRNA splicing defect?
c.1679+1G>A 1811 + 1 G>A intron 12 G to A at 1811+ 1 ? Splicing defect
c.1679+1G>C 1811+ 1G- >C intron 12 G to C at 1811+ 1 mRNA splicing defect
c.1679+24G>A 1811+ 24G- >A intron 12 G to A at 1811 + 24 mRNA splicing defect?
c.1679+34G>A 1811+ 34 G>A intron 12 G to A at1811+ 34 mRNA splicing defect
c.1679+1650T>A 1811 + 1650 T>A intron 12 1811+ 1650 T>A Sequence variation
c.1679+5A>G 1811+ 5A- >G intron 12 1811+ 5 A>G mRNA splicing defect
c.1679+1.6kbA>G 1811+ 1.6kbA- >G intron 12 A to G at 1811+ 1.2kb creation of splice donor site
c.1679+11A>G 1811+ 11A- >G intron 12 A to G at 1811+ 11 Splicing
c.1679+16T>C 1811+ 16T- >C intron 12 1811+ 16 T>C This mutation may lead to an alternative splicing, with the donor splice site located at nucleotide +18. This alternative splice site with the mutation at +16 has a higher PCU than the previously described mutation 1811+18G->A.
c.1679+24g>A intron 12
c.1679+2t>C intron 12
c.1680-1G>A 1812- 1G- >A intron 12 G to A at 1812- 1 mRNA splicing defect
c.1680-26T>C 1812- 26T- >C intron 12 T to C at 1812- 26 splicing mutation?
c.1680-5T>A 1812- 5 T- >A intron 12 1812 - 5 T>A splicing mutation?
c.1680-108T>C 1812- 108T/C intron 12 T or C at 1812- 108 sequence variation
c.1680-59T>G 1812- 59T/G intron 12 T or G at 1812- 59 sequence variation
c.1680A>C p.Arg560Ser R560S exon 13 A to C at 1812 Arg to Ser at 560
c.1680-99T>C 1812- 99 T- >C intron 12 C to T at 1812- 99 Sequence Variation?
c.1680-136A>G 1812- 136T/C intron 12 T or C at 1812- 136 sequence variation
c.1680-2a>G intron 12
c.1681_1682insC p.Val562SerfsX6 1813insC exon 13 insertion of C after 1813 (or 1814) frameshift
c.1682C>A p.Ala561Glu A561E exon 13 C to A at 1814 Ala to Glu at 561
c.1684G>C p.Val562Leu V562L exon 13 G to C at 1816 Val to Leu at 562
c.1684G>A p.Val562Ile V562I exon 13 G to A at 1816 Val to Ile at 562
c.1687T>G p.Tyr563Asp Y563D exon 13 T to G at 1819 Tyr to Asp at 563
c.1687T>A p.Tyr563Asn Y563N exon 13 T to A at 1819 Tyr to Asn at 563
c.1688A>G p.Tyr563Cys Y563C exon 13 A to G at 1820 Tyr to Cys at 563
c.1690A>G p.Lys564Glu exon 13 A to G at 1690
c.1692delA p.Asp565MetfsX7 1824delA exon 13 1824delA
c.1694A>G p.Asp565Gly D565G exon 13 A to G at 1826 Asp to Gly at 565
c.1696G>A p.Ala566Thr A566T exon 13 G to A at 1828 Ala to Thr at 566
c.1700A>G p.Asp567Gly exon 13
c.1703delT p.Leu568CysfsX4 1833delT exon 13 deletion of T at 1833 frameshift
c.1703T>A p.Leu568X L568X exon 13 T to A at 1835 Leu to Stop at 568
c.1704G>T p.Leu568Phe L568F exon 13 G to T at 1836 Leu to Phe at 568 (CBAVD?)
c.1705T>C p.Tyr569His Y569H exon 13 T to C at 1837 Tyr to His at 569
c.1705T>G p.Tyr569Asp Y569D exon 13 T to G at 1837 Tyr to Asp at 569
c.1706A>G p.Tyr569Cys Y569C exon 13 A to G at 1838 Tyr to Cys at 569
c.1707T>A p.Tyr569X Y569X exon 13 T to A at 1839 Tyr to Stop at 569
c.1712T>C p.Leu571Ser L571S exon 13 T to C at 1844 Leu to Ser at 571
c.1713_1714delAG p.Asp572LeufsX16 1845delAG/1846delGA exon 13 deletion of AG at 1845 or GA at 1846 frameshift
c.1714G>A p.Asp572Asn D572N exon 13 G to A at 1846 Asp to Asn at 572
c.1714G>C p.Asp572His exon 13
c.1718C>G p.Ser573Cys S573C exon 13 C to G at 1850 Ser to Cys at 573
c.1720C>T p.Pro574Ser P574S exon 13 C to T at 1852 Pro to Ser at 574
c.1721C>A p.Pro574His P574H exon 13 C to A at 1853 Pro to His at 574
c.1726G>T p.Gly576X G576X exon 13 G to T at 1858 Gly to Stop at 576
c.1727G>C p.Gly576Ala G576A exon 13 G to C at 1859 Gly to Ala at 576 (CAVD)
c.1727G>C p.Gly576Ala G576A exon 13 G to C at 1859 Gly to Ala at 576 (CAVD)
c.1730A>T p.Tyr577Phe Y577F exon 13 A to T at 1862 Tyr to Phe at 577
c.1731C>T Y577Y (1863C/T) exon 13 C or T at 1863 sequence variation (Tyr at 577 no change)
c.1731C>A p.Tyr577X exon 13
c.1735G>T p.Asp579Tyr D579Y exon 13 G to T at 1867 Asp to Tyr at 579
c.1736A>G p.Asp579Gly D579G exon 13 A to G at 1868 Asp to Gly at 579
c.1736A>C p.Asp579Ala D579A exon 13 A to C at 1868 Asp to Ala at 579
c.1738delG p.Val580PhefsX2 1870delG exon 13 deletion of G at 1870 frameshift
c.1739_1740insT p.Leu581PhefsX8 1874insT exon 13 insertion of T between 1871 and 1874 frameshift
c.1744A>T p.Thr582Ser T582S exon 13 A to T at 1876 Thr to Ser at 582
c.1745C>T p.Thr582Ile T582I exon 13 C to T at 1877 Thr to Ile at 582
c.1745C>G p.Thr582Arg T582R exon 13 C to G at 1877 Thr to Arg at 582
c.1753G>T p.Glu585X E585X exon 13 G to T at 1885 Glu to Stop at 585
c.1756A>G p.Ile586Val I586V exon 13 A to G at 1888 Ile to Val at 586
c.1759T>A p.Phe587Ile F587I exon 13 T to A at 1891 Phe to Ile at 587
c.1763A>T p.Glu588Val E588V exon 13 A to T at 1895 Glu to Val at 588
c.1766+5G>A 1898+ 5G- >A intron 13 G to A at 1898+ 5 mRNA splicing defect
c.1766G>A p.Ser589Asn S589N exon 13 G to A at 1898 Ser to Asn at 589 (mRNA splicing defect?)
c.1766G>T p.Ser589Ile S589I exon 13 G to T at 1898 Ser to Ile at 589 (splicing?)
c.1766+152T>A 1898+ 152T/A intron 13 T or A at 1898+ 152 sequence variation
c.1766+1G>A 1898+ 1G- >A intron 13 G to A at 1898+ 1 mRNA splicing defect
c.1766+1G>C 1898+ 1G- >C intron 13 G to C at 1898+ 1 mRNA splicing defect
c.1766+1G>T 1898+ 1G- >T intron 13 G to T at 1898+ 1 mRNA splicing defect
c.1766+30G>A 1898+ 30G/A intron 13 G or A at 1898+ 30 sequence variation?
c.1766+3A>C 1898+ 3A- >C intron 13 A to C at 1898+ 3 mRNA splicing defect?
c.1766+3A>G 1898+ 3A- >G intron 13 A to G at 1898+ 3 mRNA splicing defect?
c.1766+5G>T 1898+ 5G- >T intron 13 G to T at 1898+ 5 mRNA splicing defect
c.1766+73T>G 1898+ 73T- >G intron 13 T to G at 1898+ 73 mRNA splicing defect?
c.1766+2t>C intron 13
c.1781T>C p.Leu594Pro L594P exon 14 T to C at 1913 Leu to Pro at 594
c.1783A>G p.Met595Val exon 14
c.1784T>C p.Met595Thr M595T exon 14 T to C at 1916 Met to Thr at 595
c.1785G>A p.Met595Ile M595I exon 14 G to A at 1917 Met to Ile at 595
c.1786_1787delGC p.Ala596X 1918delGC exon 14 deletion of GC from 1918 frameshift
c.1792A>T p.Lys598X K598X exon 14 A to T at 1924 Lys to Stop at 598
c.1792_1798delAAAACTA p.Lys598GlyfsX11 1924del7 exon 14 deletion of 7 bp (AAACTA) from 1924 frameshift
c.1797T>A T599T (1929T/A) exon 14 T or A at 1929 sequence variation
c.1798A>G p.Arg600Gly R600G exon 14 A to G at 1930 Arg to Gly at 600
c.1800delG p.Ile601PhefsX10 1932delG exon 14 Deletion of G at nucleotide 1932 Frameshift a premature stop codon appears 10 codons further.
c.1801A>T p.Ile601Phe I601F exon 14 A to T at 1933 Ile to Phe at 601
c.1807G>T p.Val603Phe V603F exon 14 G to T at 1939 Val to Phe at 603
c.1811C>T p.Thr604Ile T604I exon 14 C to T at 1943 Thr to Ile at 604
c.1811C>G p.Thr604Ser T604S exon 14 C to G at 1943 Thr to Ser at 604
c.1680-13A>G 1812- 13A>G intron 12 1812- 13A>G
c.1817_1900delAAATGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCC p.Met607_Gln634del 1949del84 exon 14 deletion of 84 bp from 1949 deletion of 28 a.a. (Met607 to Gln634)
c.1823A>G p.Glu608Gly E608G exon 14 A to G at 1955 Glu to Gly at 608
c.1826A>T p.His609Leu H609L exon 14 A to T at 1958 His to Leu at 609
c.1826A>G p.His609Arg H609R exon 14 A to G at 1958 His to Arg at 609
c.1829T>C p.Leu610Ser L610S exon 14 T to C at 1961 Leu to Ser at 610
c.1837G>A p.Ala613Thr A613T exon 14 G to A at 1969 Ala to Thr at 613
c.1840G>T p.Asp614Tyr D614Y exon 14 G to T at 1972 Asp to Tyr at 614
c.1841A>G p.Asp614Gly D614G exon 14 A to G at 1973 Asp to Gly at 614
c.1853T>C p.Ile618Thr I618T exon 14 T to C at 1985 Ile to Thr at 618
c.1856T>C p.Leu619Ser L619S exon 14 T to C at 1988 Leu to Ser at 619
c.1859A>C p.His620Pro H620P exon 14 A to C at 1991 His to Pro at 620
c.1860T>G p.His620Gln H620Q exon 14 T to G at 1992 His to Gln at 620
c.1865G>A p.Gly622Asp G622D exon 14 G to A at 1997 Gly to Asp at 622 (oligospermia)
c.1871_1878delGCTATTTT p.Ser624IlefsX15 2003del8 exon 14 Deletion of GCTATTTT from 2003 Frameshift
c.1882G>C p.Gly628Arg G628R(G- >C) exon 14 G to C at 2014 Gly to Arg at 628
c.1882G>A p.Gly628Arg G628R(G- >A) exon 14 G to A at 2014 Gly to Arg at 628
c.1897C>A p.Leu633Ile L633I exon 14 C to A at 2029 Leu to Ile at 633
c.1898T>C p.Leu633Pro L633P exon 14 T to C at 2030 Leu to Pro at 633
c.1900C>T p.Gln634X Q634X exon 14 C to T at 2032 Gln to Stop at 634
c.1907T>C p.Leu636Pro L636P exon 14 T to C at 2039 Leu to Pro at 636
c.1909C>T p.Gln637X Q637X exon 14 C to T at 2041 Gln to Stop at 637
c.1911delG p.Gln637HisfsX26 2043delG exon 14 deletion of G at 2043 frameshift
c.1915G>T p.Asp639Tyr D639Y exon 14 G to T at 2047 Asp to Tyr at 639
c.1919_1920delTT p.Phe640X 2051delTT exon 14 deletion of TT from 2051 frameshift
c.1920T>C p.Phe640Phe exon 14
c.1920_1921dupTA p.Ser641IlefsX23 exon 14
c.1923_1931del9insA p.Ser641ArgfsX5 2055del9- >A exon 14 deletion of 9 bp CTCAAAACT to A at 2055 frameshift
c.1932C>G 2064C/G exon 14 C or G at 2064 sequence variation (Leu at 644 no change)
c.1950C>T 2082C/T exon 14 C or T at 2082 sequence variation (no change Phe at 650)
c.1951G>C p.Asp651His D651H exon 14 G to C at 2083 Asp to His at 651
c.1951G>A p.Asp651Asn D651N exon 14 G to A at 2083 Asp to Asn at 651
c.1960A>G p.Ser654Gly 2092A/G exon 14 A or G at 2092 sequence variation
c.1966G>T p.Glu656X E656X exon 14 G to T at 2098 Glu to Stop at 656
c.1972_1973insA p.Arg658LysfsX7 2104insA+ 2109- 2118del10 exon 14 insertion of A at 2104, deletion of 10bp at 2109 ?
c.1973_1985del13insAGAAA p.Arg658LysfsX4 2105- 2117del13insAGAAA exon 14 Deletion of 13 bp and insertion of AGAAA at 2105- 2117 Frameshift
c.1976delA p.Asn659IlefsX4 2108delA exon 14 deletion of A at 2108 frameshift
c.1978T>A p.Ser660Thr S660T exon 14 T to A at 2110 Ser to Thr a 660
c.1981delA p.Ile661SerfsX2 2113delA exon 14 deletion of A at 2113 frameshift
c.1984_1987delCTAA p.Thr663ArgfsX8 2116delCTAA exon 14 deletion of CTAA at 2116 frameshift
c.1986_1989delAACT p.Thr663ArgfsX8 2118del4 exon 14 deletion of AACT from 2118 frameshift
c.1990G>T p.Glu664X E664X exon 14 G to T at 2122 Glu to Stop at 664
c.1993A>T p.Thr665Ser T665S exon 14 A to T at 2125 Thr to Ser at 665
c.2002C>T p.Arg668Cys R668C exon 14 C or T at 2134 sequence variation
c.2009_2010insA p.Leu671IlefsX18 2141insA exon 14 insertion of A after 2141 frameshift
c.2012delT p.Leu671X 2143delT exon 14 deletion of T at 2143 frameshift
c.2013_2015delAGA p.Glu672del E672del exon 14 deletion of 3 bp between 2145- 2148 deletion of Glu at 672
c.2017G>T p.Gly673X G673X exon 14 G to T at 2149 Gly to Stop at 673
c.2021A>T p.Asp674Val D674V exon 14 A to T at 2153 Asp to Val at 674
c.2036G>A p.Trp679X W679X exon 14 G to A at 2168 Trp to Stop at 679
c.2044_2045insC p.Gln685ThrfsX4 2176insC exon 14 insertion of C after 2176 frameshift
c.2044delA p.Thr682GlnfsX40 exon 14
c.2048A>G p.Lys683Arg K683R exon 14 A to G at 2180 Lys to Arg at 683
c.2051_2052delAA p.Lys684ThrfsX4 2183delAA exon 14 deletion of AA at 2183 frameshift
c.2051_2052delAAinsG p.Lys684SerfsX38 2183AA- >G exon 14 A to G at 2183 and deletion of A at 2184 frameshift
c.2052A>G 2184A/G exon 14 A to G at 2184 no change
c.2052_2053insA p.Gln685ThrfsX4 2184insA exon 14 insertion of A after 2184 frameshift
c.2052delA p.Lys684AsnfsX38 2184delA exon 14 deletion of A at 2184 frameshift
c.2053C>T p.Gln685X Q685X exon 14 C to T at 2185 Gln to Stop at 685
c.2053_2054insC p.Gln685ProfsX4 2185insC exon 14 insertion of C at 2185 frameshift
c.2057C>A p.Ser686Tyr S686Y exon 14 C to A at 2189 Ser to Tyr at 686
c.2061_2062insTTTT p.Lys688PhefsX? 2193ins4 exon 14 Insertion of 4T at 2193 Frameshift
c.2062A>T p.Lys688X K688X exon 14 A toT at 2194 Lys to Stop at 688
c.2065C>T p.Gln689X Q689X exon 14 C to T at 2197 Gln to Stop at 689
c.2074G>T p.Glu692X E692X exon 14 G to T at 2206 Glu to Stop at 692
c.2077T>C p.Phe693Leu F693L(CTT) exon 14 T to C at 2209 Phe to Leu at 693
c.2079T>G p.Phe693Leu F693L(TTG) exon 14 T to G at 2211 Phe to Leu at 693
c.2083_2084insG p.Glu695GlyfsX35 2215insG exon 14 insertion of G at 2215 frameshift
c.2087A>G p.Lys696Arg exon 14
c.2089_2090insA p.Arg697LysfsX33 2221insA exon 14 insertion of A at 2221 Frameshift a premature stop codon appears 33 codons further
c.2106C>G 2238C/G exon 14 C or G at 2238 sequence variation
c.2125C>T p.Arg709X R709X exon 14 C to T at 2257 Arg to Stop at 709
c.2126G>A p.Arg709Gln R709Q exon 14 G to A at 2258 Arg to Gln at 709
c.2128A>T p.Lys710X K710X exon 14 A to T at 2260 Lys to Stop at 710
c.2135C>G p.Ser712Cys S712C exon 14 C to G at 2267 Ser to Cys at 712
c.2143C>T p.Gln715X Q715X exon 14 C to T at 2275 Gln to Stop at 715
c.2145_2146delAAinsGT p.Lys716X K716X exon 14 AA to GT at 2277 and 2278 Lys to Stop at 716
c.2156T>A p.Leu719X L719X exon 14 T to A at 2288 Leu to Stop at 719
c.2157_2163delinsGT p.Gln720MetfsX11 2289- 2295del7bpinsGT exon 14 Deletion of 7 bp and insertion of GT at 2289- 2295 Frameshift
c.2158C>T p.Gln720X Q720X exon 14 C to T at 2290 Gln to Stop at 720
c.2168G>T p.Gly723Val G723V exon 14 G to T at 2300 Gly to Val at 723
c.2173G>A p.Glu725Lys E725K exon 14 G to A at 2305 Glu to Lys at 725
c.2175_2176insA p.Glu726ArgfsX4 2307insA exon 14 insertion of A after 2307 frameshift
c.2188G>T p.Glu730X E730X exon 14 G to T at 2320 Glu to Stop at 730
c.2195T>G p.Leu732X L732X exon 14 T to G at 2327 Leu to Stop at 732
c.2203delA p.Arg735GlyfsX4 2335delA exon 14 deletion of A at 2335 frameshift
c.2204G>A p.Arg735Lys R735K exon 14 G to A at 2336 Arg to Lys at 735
c.2210C>T p.Ser737Phe S737F exon 14 C to T at 2342 missense
c.2210C>T p.Ser737Phe S737F exon 14 C to T at 2342 Ser to Phe at 737
c.2215delG p.Val739TyrfsX16 2347delG exon 14 deletion of G at 2347 frameshift
c.2233G>T p.Gly745X G745X(Gly745X) exon 14 G to T at 2365 Non-sense mutation
c.2240_2247delCGATACTG p.Ile748SerfsX28 2372del8 exon 14 deletion of 8 bp from 2372 frameshift
c.2245C>T 2377C/T exon 14 C or T at 2377 sequence variation (no change for Leu at 749)
c.2248_2255del p.Pro750GlnfsX26 2380_2387del exon 14 Deletion of 8 bp from 2380 Frameshift
c.2249C>T p.Pro750Leu P750L exon 14 C to T at 2381 Pro to Leu at 750
c.2251C>T p.Arg751Cys R751C exon 14 2383C>T
c.2252G>C p.Arg751Pro R751P exon 14 G to C at 2384 Arg to Pro at 751
c.2255T>G p.Ile752Ser I752S exon 14 T to G at 2387 (ATC- >AGC) Ileu to Ser at 752
c.2259C>T No Changes 2391 C/T exon 14 2391 C>T Polymorphism
c.2259C>G p.Ser753Arg S753R exon 14 C to G at position 2391 Serine to arginine at 753
c.2259C>G p.Ser753Arg exon 14
c.2260G>A p.Val754Met V754M exon 14 G to A at 2392 Val to Met at 754
c.2276_2277delCC p.Pro759HisfsX19 2406delCC exon 14 deletion of CC at 2406 Frameshift
c.2277delC p.Thr760ArgfsX11 2409delC exon 14 Deletion of C at 2409 Frameshift
c.2279C>T p.Thr760Met T760M exon 14 C to T at 2411 Thr to Met at 760
c.2280G>A 2412G/A exon 14 G to A at 2412 Sequence variation?
c.2286G>T p.Gln762His 2418GG>T exon 14 G to T at 2418 missense
c.2290C>T p.Arg764X R764X exon 14 C to T at 2422 Arg to Stop at 764
c.2291delG p.Arg764GlnfsX7 2423delG exon 14 deletion of G at 2423 frameshift
c.2295G>T p.Arg765Ser exon 14
c.2297G>T p.Arg766Met R766M exon 14 G to T at 2429 Arg to Met at 766
c.2324_2325delAC p.His775LeufsX3 2456delAC exon 14 deletion of AC at 2456 frameshift
c.2327C>G p.Ser776X S776X exon 14 C to G at 2459 Ser to Stop at 776
c.2341C>T p.Gln781X Q781X exon 14 C to T at 2473 Gln to Stop at 781
c.2346C>A p.Asn782Lys N782K exon 14 C to A at 2478 Asn to Lys at 782
c.2353C>T p.Arg785X R785X exon 14 C to T at 2485 Arg to Stop at 785
c.2361_2362ins8 p.Thr788fsX? 2493ins8 exon 14 insertion of 8bp after 2493 frameshift
c.2363C>T p.Thr788Ile T788I exon 14 C to T at 2495 Thr to Ile at 788
c.2374C>G p.Arg792Gly R792G exon 14 C to G at 2506 Arg to Gly at 792
c.2374C>T p.Arg792X R792X exon 14 C to T at 2506 Arg to Stop at 792
c.2380delG p.Val794CysfsX9 2512delG exon 14 Deletion of G at 2512 Frameshift
c.2390_2391insC p.Gln799SerfsX6 2522insC exon 14 insertion of C after 2522 frameshift
c.2392C>T p.Pro798Ser P798S exon 14 2524C>T
c.2399C>G p.Ala800Gly A800G exon 14 C to G at 2531 Ala to Gly at 800
c.2417A>G p.Asp806Gly D806G exon 14 A to G at 2549 Asp to Gly at 806
c.2419A>G p.Ile807Val I807V exon 14 A to G at 2551 Ile to Val at 807
c.2421A>G p.Ile807Met I807M exon 14 A or G at 2553 sequence variation
c.2421A>G p.Ile807Met 2553A/G exon 14 A or G at 2553 sequence variation
c.2424_2425insAT p.Ser809IlefsX13 2556insAT exon 14 insertion of AT after 2556 frameshift
c.2428A>G p.Arg810Gly R810G exon 14 A to G at 2560 Arg to Gly at 810
c.2433_2437delinsATA p.Leu812TyrfsX10 exon 14
c.2434_2435insT p.Leu812PhefsX11 2566insT exon 14 insertion of T after 2566 frameshift
c.2437T>C p.Ser813Pro S813P exon 14 T to C at 2569 Ser to Pro at 813
c.2440C>T p.Gln814X Q814X exon 14 C to T at 2572 Gln to Stop at 814
c.2450G>T p.Gly817Val exon 14
c.2453delT p.Leu818TrpfsX3 2585delT exon 14 deletion of T at 2585 stop codon at amino acid 820
c.2462_2463delGT p.Ser821ArgfsX4 exon 14
c.2464G>A p.Glu822Lys E822K exon 14 G to A at 2596 Glu to Lys at 822
c.2464G>T p.Glu822X E822X exon 14 G to T at 2596 Glu to Stop at 822
c.2467G>T p.Glu823X E823X exon 14 G to T at 2599 Glu to Stop at 823
c.2472delT p.Asn825ThrfsX5 2603delT exon 14 deletion of T at 2603/4 frameshift
c.2476G>A p.Glu826Lys E826K exon 14 G to A at 2608 Glu to Lys at 826
c.2479G>T p.Glu827X E827X exon 14 G to T at 2611 Glu to Stop at 827
c.2483A>G p.Asp828Gly D828G exon 14 A to G at 2615 Asp to Gly at 828
c.2487A>G L829L (2619A/G) exon 14 A or G at 2619 sequence variation
c.2488A>T p.Lys830X K830X exon 14 A to T at 2620 Lys to Stop at 830
c.2490+2_2490+7delTAGGTA 2622+ 2del6 intron 14 deletion of TAGGTA from 2622+ 2 mRNA splicing defect
c.2490+1G>A 2622+ 1G- >A intron 14 G to A at 2622+ 1 mRNA splicing defect
c.2490+1G>T 2622+ 1G- >T intron 14 G to T at 2622+ 1 splice mutation
c.2490+2T>C 2622+ 2T>C intron 14 T to C at 2622+ 2 mRNA splicing defect
c.2490+14G>A 2622+ 14G/A intron 14 G or A at 2622+ 14 sequence variation
c.2491-2A>G 2623- 2A- >G intron 14 A to G at 2623- 2 Splicing
c.2491G>T p.Glu831X E831X exon 15 G to T at 2623 Glu to Stop at 831
c.2491-23A>G 2623- 23A- >G intron 14 2623- 23 A>G mRNA splicing defect?
c.2491-11C>T 2623- 11 C- >T intron 14 2623- 11 C>T Polymorphism
c.2491-190g>A intron 14
c.2491-88c>T intron 14
c.2502_2503insT p.Asp835X 2634insT exon 15 insertion of T after 2634 frameshift
c.2502T>G p.Phe834Leu exon 15
c.2502delT p.Phe834LeufsX10 2634delT exon 15 Deletion of T at 2634 frameshift
c.2506G>T p.Asp836Tyr D836Y exon 15 G to T at 2638 Asp to Tyr at 836
c.2508delT p.Asp836GlufsX8 2640delT exon 15 deletion of T at 2640 frameshift
c.2519T>C p.Ile840Thr I840T exon 15 T to C at 2651 Ile to Thr at 840
c.2522C>G p.Pro841Arg P841R exon 15 C to G at 2654 Pro to Arg at 841
c.2537G>A p.Trp846X W846X exon 15 G to A at 2669 Trp to Stop at 846
c.2538G>A p.Trp846X W846X (2670TGG>TGA) exon 15 G to A at 2670 Trp to Stop at 846
c.2547C>A p.Tyr849X Y849X exon 15 C to A at 2679 Tyr to Stop at 849
c.2551C>T p.Arg851X R851X exon 15 C to T at 2683 Arg to Stop at 851
c.2552G>T p.Arg851Leu R851L exon 15 G to T at 2684 Arg to Leu at 851
c.2556T>G p.Tyr852X Y852X exon 15 T to G at 2688 Tyr to stop at 852 (Premature termination)
c.2559T>C 2691T/C exon 15 T or C at 2691 sequence variation
c.2562T>G 2694T/G exon 15 T or G at 2694 sequence variation
c.2562T>C 2694T/C exon 15 T or C at 2694 sequence variation
c.2562delT p.Val855SerfsX5 2694delT exon 15 deletion of T at 2694 frameshift
c.2563G>A p.Val855Ile V855I exon 15 G to A at 2695 Val to Ile at 855 (sequence variation?)
c.2566_2567insT p.His856LeufsX40 exon 15
c.2571G>A 2703G/A exon 15 G or A at 2703 sequence variation (Lys at 857 no change)
c.2583delT p.Phe861LeufsX3 2711delT exon 15 deletion of T at 2711 frameshift
c.2579T>C p.Ile860Thr I860T exon 15 2711T>C
c.2589_2599delAATTTGGTGCT p.Ile864SerfsX28 2721del11 exon 15 deletion of 11 bp from 2721 frameshift
c.2591_2592delTT p.Ile864MetfsX31 2723delTT exon 15 deletion of TT from 2723 frameshift
c.2596T>G p.Cys866Gly C866R exon 15 T to G at 2728 Cys to Arg at 866
c.2596T>A p.Cys866Ser C866S exon 15 T to A at 2728 Cys to Ser at 866
c.2597G>A p.Cys866Tyr C866Y exon 15 G to A at 2729 Cys to Tyr at 866
c.2600T>A p.Leu867X L867X exon 15 T to A at 2732 Leu to Stop at 867
c.2600_2601insA p.Val868SerfsX28 2732insA exon 15 insertion of A at 2732 frameshift
c.2602delG p.Val868X 2734G- >AT exon 15 Deletion of G at 2734 with insertion of AT frameshift
c.2604A>G No Changes 2736G/A exon 15 G or A at 2736 sequence variation
c.2615delC p.Ala872GlufsX34 2747delC exon 15 Deletion of C at nucleotide 2747 Frameshift a premature stop codon appears 34 codons further
c.2619G>A 2751G- >A exon 15 G to A at 2751 mRNA splicing defect?
c.2619+3A>G 2751+ 3A- >G intron 15 A to G at 2751+ 3 mRNA splicing defect? (CBAVD)
c.2619+18_2619+23del IVS14a+ 17del5 intron 15 5 bp deletion between 2751+ 17 and 2751+ 24 sequence variation
c.2619+2T>A 2751+ 2T- >A intron 15 T to A at 2751+ 2 mRNA splicing defect
c.2620-17G>A 2752- 17G/A intron 15 G to A at 2752- 17 sequence variation
c.2620-6T>C 2752- 6T- >C intron 15 T to C at 2752- 6 Splicing
c.2620-26A>G 2752- 26A- >G intron 15 A to G at 2752- 26 mRNA splicing defect?
c.2620-1G>T 2752- 1G- >T intron 15 G to T at 2752- 1 mRNA splicing defect
c.2620-15C>G 2752- 15C/G intron 15 C or G at 2752- 15 sequence variation
c.2620-2A>G 2752- 2A>G intron 15 A to G at 2752- 2 mRNA splicing defect
c.2620-1G>C 2752- 1G- >C intron 15 G to C at 2752- 1 splice mutation
c.2620-22A>G 2752- 22A/G intron 15 A or G at 2752- 22 sequence variation
c.2620-97C>T 2752- 97C- >T intron 15 C to T at 2752- 97 Splicing
c.2620-17g>T intron 15
c.2620-25dupA 2752- 33insA intron 15 2752- 33insA
c.2620-18delT intron 15
c.2629_2631delTCT p.Ser877del S877del exon 16 2761delTCT
c.2634_2641delGGTTGTGC p.Leu878PhefsX15 2766del8 exon 16 deletion of 8 bp from 2766 frameshift
c.2645G>A p.Trp882X W882X exon 16 G to A at 2777 Trp to Stop at 882
c.2655_2670delAAACACTCCTCTTCAA p.Asn886ThrfsX15 2787del16 exon 16 - intron 16 Deletion of 16 nucleotides from 2787 Splicing mutation.
c.2657+2_2657+3insA 2789+ 2insA intron 16 insertion of A after 2789+ 2 mRNA splicing defect? (CAVD)
c.2657+32T>C 2789+ 32T/C intron 16 T or C at 2789+ 32 sequence variation
c.2657+3delG 2789+ 3delG intron 16 deletion of G at 2789+ 3 mRNA splicing defect
c.2657+5G>A 2789+ 5G>A intron 16 G to A at 2789+ 5 mRNA splicing defect
c.2658-1G>T 2790- 1G- >T intron 16 G to T at 2790- 1 mRNA splicing defect
c.2658-21G>A 2790- 21G/A intron 16 G or A at 2790- 21 sequence variation
c.2658-1G>C 2790- 1G- >C intron 16 G to C at 2790- 1 mRNA splicing defect
c.2658-2A>G 2790- 2A- >G intron 16 A to G at 2790- 2 mRNA splicing defect
c.2658-107G>C 2790- 108G/C intron 16 G or C at 2790- 108 sequence variation
c.2668C>T p.Gln890X Q890X exon 17 C to T at 2800 Gln to Stop at 890
c.2669A>G p.Gln890Arg Q890R exon 17 A to G at 2801 Gln to Arg at 890
c.2672A>G p.Asp891Gly D891G exon 17 A to G at 2804 Asp to Gly at 891
c.2679G>T 2811G/T exon 17 G or T at 2811 sequence variation
c.2684G>C p.Ser895Thr S895T exon 17 G to C at 2816 Ser to Thr at 895
c.2686_2687insT p.Thr896IlefsX3 exon 17
c.2687C>T p.Thr896Ile T896I exon 17 C to T at 2819 Thr to Ile at 896
c.2687_2690delCTCAinsTGAGTACTATGAG p.Thr896IlefsX9 2819del4bpins13bp exon 17 delete 4bp(CTCA) at 2819, insert 13 bp (TGAGTACTATGAG) at 2819 Thr to Met at 896, His to Ser at 897, insertion of Thr, Met and Ser after 897
c.2699A>C p.Asn900Thr N900T exon 17 A to C at 2831 Asn to Thr at 900
c.2706C>G p.Ser902Arg S902R exon 17 C to G at 2838 Ser to Arg at 902
c.2707T>C p.Tyr903His 2839T/C exon 17 T or C at 2839 sequence variation
c.2712A>T 2844A/T exon 17 A or T at 2844 sequence variation (Ala at 904 no change)
c.2719A>G p.Ile907Val 2851A/G exon 17 A or G at 2851 Ile or Val at 907
c.2723C>A p.Thr908Asn T908N exon 17 C to A at 2855 Thr to Asn at 908
c.2724C>T 2856C/T exon 17 C or T at 2856 sequence variation (Thr at 908 no change)
c.2726G>T p.Ser909Ile 2858G/T exon 17 G or T at 2858 sequence variation
c.2731A>C p.Ser911Arg S911R exon 17 A to C at 2863 or T to A or T to G at 2865 Ser to Arg at 911
c.2735C>T p.Ser912Leu S912L exon 17 C to T at 2867 Ser to Leu at 912
c.2735C>A p.Ser912X S912X exon 17 C to A at 2867 Ser to Stop at 912
c.2736G>A 2868 G/A exon 17 G to A at 2868 sequence variation
c.2737_2738insG p.Tyr913X 2869insG exon 17 insertion of G after 2869 frameshift
c.2738A>G p.Tyr913Cys Y913C exon 17 A to G at 2870 Tyr to Cys at 913
c.2739T>A p.Tyr913X Y913X exon 17 T to A at 2871 Tyr to Stop at 913
c.2741A>G p.Tyr914Cys Y914C exon 17 A to G at 2873 Tyr to Cys at 914
c.2743G>C p.Val915Leu exon 17
c.2749T>G p.Tyr917Asp Y917D exon 17 T to G at 2881 Tyr to Asp at 917
c.2750A>G p.Tyr917Cys Y917C exon 17 A to G at 2882 Tyr to Cys at 917
c.2754T>G p.Ile918Met I918M exon 17 T to G at 2886 Ile to Met at 918
c.2756A>G p.Tyr919Cys Y919C exon 17 A to G at 2888 Tyr to Cys at 919
c.2758G>A p.Val920Met V920M exon 17 G to A at 2890 Val to Met at 920
c.2758G>T p.Val920Leu V920L exon 17 G to T at 2890 Val to Leu at 920
c.2762G>A p.Gly921Glu G921E exon 17 2894G>A
c.2764G>C p.Val922Leu V922L exon 17 G to C at 2896 Val to Leu at 922
c.2764_2765insAG p.Val922GlufsX2 2896insAG exon 17 insertion of AG after 2896 frameshift
c.2769C>T 2901C/T exon 17 C or T at 2901 sequence variation
c.2770G>A p.Asp924Asn D924N exon 17 G to A at 2902 Asp to Asn at 924
c.2770G>T p.Asp924Tyr D924Y exon 17 2902G>T
c.2775_2776delTT p.Leu926AlafsX48 2907delTT exon 17 deletion of TT from 2907 frameshift
c.2777delT p.Leu926CysfsX16 2909delT exon 17 deletion of T at 2909 frameshift
c.2778G>T p.Leu926Phe exon 17
c.2780T>C p.Leu927Pro L927P exon 17 T to C at 2912 Leu to Pro at 927
c.2795T>C p.Phe932Ser F932S exon 17 T to C at 2927 Phe to Ser at 932
c.2797A>G p.Arg933Gly R933G exon 17 A to G at 2929 Arg to Gly at 933
c.2799A>T p.Arg933Ser R933S exon 17 A to T at 2931 Arg to Ser at 933 (CBAVD)
c.2803_2813delCTACCACTGGT p.Leu935AlafsX36 exon 17
c.2805_2810delinsTCAGA p.Leu941X exon 17
c.2806C>A p.Pro936Thr exon 17
c.2808A>G 2940A/G exon 17 A or G at 2940 sequence variation
c.2810_2811insT p.Val938GlyfsX37 2942insT exon 17 insertion of T at 2942 frameshift resulting in premature termination at codon 974
c.2812G>C p.Val938Leu V938L exon 17 G to C at 2944 Val to Leu at 938
c.2813T>G p.Val938Gly V938G exon 17 T to G at 2945 Val to Gly at 938 (CAVD)
c.2815C>G p.His939Asp H939D exon 17 C to G at 2947 His to Asp at 939
c.2816A>G p.His939Arg H939R exon 17 A to G at 2948 His to Arg at 939
c.2816_2817delATinsC p.His439ProfsX 2948AT- >C exon 17 AT to C at 2948 frameshift resulting in premature termination at 2953
c.2820T>C p.Thr940Thr exon 17
c.2825delT p.Ile942ThrfsX26 2957delT exon 17 2957delT
c.2834C>T p.Ser945Leu S945L exon 17 C to T at 2966 Ser to Leu at 945
c.2835G>A 2967G/A exon 17 G or A at 2967 sequence variation (no change for Ser at 945)
c.2836A>T p.Lys946X K946X exon 17 A to T at 2968 Lys to Stop at 946
c.2845C>T p.His949Tyr H949Y exon 17 C to T at 2977 His to Tyr at 949
c.2846A>G p.His949Arg H949R exon 17 A to G at 2978 His to Arg at 949
c.2846A>T p.His949Leu H949L exon 17 A to T at 2978 His to Leu at 949
c.2855T>C p.Met952Thr M952T exon 17 T to C at 2987 Met to Thr at 952
c.2856G>C p.Met952Ile M952I exon 17 G to C at 2988 Met to Ile at 952 CBAVD mutation?
c.2859_2890delACATTCTGTTCTTCAAGCACCTATGTCAACCC p.Leu953PhefsX11 2991del32 exon 17 deletion of 32 bp from 2991 to 3022 frameshift
c.2861A>C p.His954Pro exon 17
c.2875delG p.Ala959HisfsX9 3007delG exon 17 deletion of G at 3007 frameshift
c.2876C>T p.Ala959Val A959V exon 17 C to T at 3008 Ala to Val at 959
c.2876delC p.Ala959AspfsX9 exon 17
c.2883G>T p.Met961Ile M961I exon 17 G to T at 3015 Met to Ile at 961
c.2896delA p.Thr966ArgfsX2 3028delA exon 17 deletion of A at 3028 frameshift
c.2898G>A 3030G/A exon 17 G or A at 3030 sequence variation
c.2900T>C p.Leu967Ser L967S exon 17 T to C at 3032 Leu to Ser at 967 (oligospermia?)
c.2908G>C p.Gly970Arg G970R exon 17 G to C at 3040 Gly to Arg at 970
c.2908G>A p.Gly970Ser G970S exon 17 G to A at 3040 Gly to Ser at 970
c.2908+11A>T 3040+ 11A/T intron 17 3040+ 11 A>T Polymorphism
c.2908+23T>C 3040+ 23T- >C intron 17 T to C at 3040+ 23 Splicing
c.2908+2T>C 3040+ 2T- >C intron 17 T to C at 3040+ 2 mRNA splicing defect
c.2908+1085_3367+260del7201 CFTR- dele 16- 17a- 17b intron 17 - exon 20 3040+ 1085_3499+ 260del7201 Large in frame deletion removing exons 16,17a,17b
c.2909-11_2909-5del 3041- 11del7 intron 17 deletion of GTATATT at 3041- 11 mRNA splicing mutation?
c.2909-1G>A 3041- 1G- >A intron 17 G to A at 3041- 1 mRNA splicing defect
c.2909-15T>G 3041- 15T- >G intron 17 T to G at 3041- 15 mRNA splicing mutation?
c.2909-4A>G 3041- 4A- >G intron 17 A to G at 3041- 4 splicing
c.2909-51T>G 3041- 51 T/G intron 17 3041 - 51 T>G sequence variation?
c.2909-92G>A 3041- 92G/A intron 17 G or A at 3041- 92 sequence variation
c.2909-71G>C 3041- 71G/C intron 17 G or C at 3041- 71 sequence variation
c.2909G>A p.Gly970Asp G970D exon 18 G to A at 3041 Gly to Asp at 970
c.2909delG p.Gly970ValfsX11 3041delG exon 18 deletion of G at 3041 frameshift
c.2909-50C>G 3041- 52C/G intron 17 C or G at 3041- 52 sequence variation
c.2916_2917delTCinsAT p.Leu973Phe L973F exon 18 TC to AT at 3048 and 3049 Leu to Phe at 973 (CBAVD)
c.2918T>C p.Leu973Pro L973P exon 18 T to C at 3050 Leu to Pro at 973
c.2918T>A p.Leu973His L973H exon 18 T to A at 3050 Leu to His at 973
c.2924_2925delGA p.Arg975IlefsX10 3056delGA exon 18 deletion of GA from 3056 frameshift
c.2929T>C p.Ser977Pro S977P exon 18 T to C at 3061 Ser to Pro at 977
c.2930C>T p.Ser977Phe S977F exon 18 C to T at 3062 Ser to Phe at 977
c.2930C>G p.Ser977Cys exon 18
c.2932A>T p.Lys978X exon 18
c.2932A>T p.Lys978X K978X exon 18 3064A>T
c.2936A>T p.Asp979Val D979V exon 18 A to T at 3068 Asp to Val at 979
c.2936A>C p.Asp979Ala D979A exon 18 A to C at 3068 Asp to Ala at 979 (CBAVD?)
c.2939T>A p.Ile980Lys I980K exon 18 T to A at 3071 Ile to Lys at 980
c.2940A>G p.Ile980Met I980M exon 18 A to G at 3072 Ile to Met at 980
c.2947_2948delTT p.Leu983GlyfsX2 3079delTT exon 18 deletion of TT from 3079 frameshift
c.2953G>C p.Asp985His D985H exon 18 G to C at 3085 Asp to His at 985
c.2953G>T p.Asp985Tyr D985Y exon 18 G to T at 3085 Asp to Tyr at 985
c.2963C>G p.Pro988Arg exon 18
c.2968A>T p.Thr990Ser exon 18
c.2968_2969insA p.Thr990AsnfsX4 3100insA exon 18 insertion of A after 3100 frameshift
c.2971A>G p.Ile991Val I991V exon 18 A to G at 3103 Ile to Val at 991
c.2977G>T p.Asp993Tyr D993Y exon 18 G to T at 3109 Asp to Tyr at 993
c.2978A>G p.Asp993Gly D993G exon 18 A to G at 3110 Asp to Gly at 993
c.2981T>G p.Phe994Cys F994C exon 18 T to G at 3113 Phe to Cys at 994
c.2988G>A 3120G- >A exon 18 G to A at 3120 mRNA splicing defect
c.2988+198G>A 3120+ 198G- >A intron 18 G to A at 3120+ 198 Splicing
c.2988+1G>A 3120+ 1G- >A intron 18 G to A at 3120+ 1 mRNA splicing defect
c.2988+45A>G 3120+ 45A/G intron 18 A or G at 3120+ 45 sequence variation
c.2988+35A>T 3120+ 35 A- >T intron 18 A to T at 3120+ 35 mRNA splicing defect?
c.2988+2t>C intron 18
c.2988+33g>T 3120+ 33G>T intron 18
c.2988+41delA 3120+ 41delA intron 18 Delete A at 3120+ 41 sequence variation
c.2989-3C>G 3121- 3C- >G intron 18 C to G at 3121- 3 mRNA splicing
c.2989-14C>A 3121- 14C/A intron 18 C or A at 3121- 14 Sequence variation
c.2989-2A>G 3121- 2A- >G intron 18 A to G at 3121- 2 mRNA splicing defect
c.2989-1G>A 3121- 1G- >A intron 18 G to A at 3121- 1 mRNA splicing defect
c.2989-2A>T 3121- 2A- >T intron 18 A to T at 3121- 2 mRNA splicing defect
c.2989-14c>A intron 18
c.2989-92a>G intron 18
c.2989-93A[12_13] 3121- 92A12/13 intron 18 12A or 13A at 3121- 92 sequence variation
c.2991G>C p.Leu997Phe L997F exon 19 G or C at 3123 Leu or Phe at 997 (sequence variation)
c.2994_2997delATTA p.Ile1000X 3126del4 exon 19 deletion of ATTA from 3126 frameshift
c.2997_3000delAATT p.Ile1000X 3129del4 exon 19 deletion of 4 bp from 3129 frameshift
c.2998_3012del p.Val1001_Ile1005del 3131del15 exon 19 deletion of 15 bp from 3130, 3131, or 3132 deletion of Val at 1001 to Ile at 1005
c.2998_3012del p.Ile1000_Ile1005del 3130del15 exon 19 delete 15 nucleotide at 3130 In fram in/del
c.2998delA p.Ile1000LeufsX2 3130delA exon 19 Deletion of A at 3130 frameshift
c.3002_3003delTG p.Val1001AspfsX45 3132delTG exon 19 deletion of TG from 3132 frameshift
c.3007G>T p.Gly1003X G1003X exon 19 G to T at 3139 Gly to Stop at 1003
c.3008G>A p.Gly1003Glu G1003E exon 19 G to A at 3140 Gly to Glu at 1003
c.3009_3017delAGCTATAGC p.Ala1004_Ala1006del 3141del9 exon 19 del AGCTATAGC from 3141 Frameshift
c.3014T>G p.Ile1005Arg I1005R exon 19 T to G at 3146 Ile to Arg at 1005
c.3017C>A p.Ala1006Glu A1006E exon 19 C to A at 3149 Ala to Glu at 1006
c.3021delT p.Val1008SerfsX15 3152delT exon 19 delete T at 3152 frameshift
c.3021delT p.Val1008SerfsX15 3153delT exon 19 deletion of T at 3153 frameshift
c.3022delG p.Val1008SerfsX15 3154delG exon 19 deletion of G at 3154 frameshift
c.3023T>A p.Val1008Asp V1008D exon 19 T to A at 3155 Val to Asp at 1008
c.3025G>A p.Ala1009Thr A1009T exon 19 G to A at 3157 Ala to Thr at 1009
c.3038C>T p.Pro1013Leu P1013L exon 19 C to T at 3170 Pro to Leu at 1013
c.3038C>A p.Pro1013His P1013H exon 19 C to A at 3170 Pro to His at 1013
c.3039_3040insC p.Tyr1014LeufsX33 3171insC exon 19 insertion of C after 3171 frameshift
c.3039delC p.Tyr1014ThrfsX9 3171delC exon 19 deletion of C at 3171 frameshift resulting in premature termination at 1022
c.3041A>G p.Tyr1014Cys Y1014C exon 19 A to G at 3173 Tyr to Cys at 1014
c.3041_3042delAC p.Ile1015LeufsX31 3173delAC exon 19 deletion of AC from 3173 frameshift
c.3047T>C p.Phe1016Ser F1016S exon 19 T to C at 3179 Phe to Ser at 1016
c.3059T>A p.Val1020Glu V1020E exon 19 T to A at 3191 Val to Glu at 1020
c.3061C>G p.Pro1021Ala P1021A exon 19 C to G at 3193 Pro to Ala at 1021
c.3061C>T p.Pro1021Ser P1021S exon 19 C to T at 3193 Pro to Ser at 1021 (CBAVD)
c.3063_3068delAGTGAT p.Ile1023_Val1024del 3195del6 exon 19 deletion of AGTGAT from 3195 to 3200 deletion of Val1022 and Ile1023
c.3064_3117delGTGATAGTGGCTTTTATTATGTTGAGAGCATATTTCCTCCAAACCTCACAGCAA p.Val1022_Gln1039del 3196del54 exon 19 deletion of 54 bp from 3196 deletion of 18 aa from codon 1022
c.3067_3072delATAGTG p.Ile1023_Val1024del 3199del6 exon 19 deletion of ATAGTG from 3199 deletion of Ile at 1023 and Val at 1024
c.3068_3072delTAGTG p.Ile1023SerfsX22 3200_3204delTAGTG exon 19 Deletion of TAGTG from 3200 Frameshift
c.3068T>C p.Ile1023Thr I1023T exon 19 3200T>C
c.3074C>A p.Ala1025Asp A1025D exon 19 C to A at 3206 Substitution of alanine to aspartic acid at position 1025
c.3080T>C p.Ile1027Thr I1027T exon 19 T to C at 3212 Ile to Thr at 1027
c.3083T>G p.Met1028Arg M1028R exon 19 T to G at 3215 Met to Arg at 1028
c.3084G>T p.Met1028Ile M1028I exon 19 G to T at 3216 Met to Ile at 1028
c.3094T>A p.Tyr1032Asn Y1032N exon 19 T to A at 3226 Tyr to Asn at 1032
c.3095A>G p.Tyr1032Cys Y1032C exon 19 A to G at 3227 Tyr to Cys at 1032 (CBAVD)
c.3103C>T p.Gln1035X Q1035X exon 19 C to T at 3235 Nonsense mutation
c.3106delA p.Thr1036LeufsX? 3238delA exon 19 3238delA frameshift
c.3118C>T p.Leu1040Phe exon 19
c.3124C>T p.Gln1042X Q1042X exon 19 C to T at 3256 Gln to Stop at 1042
c.3131A>G p.Glu1044Gly exon 19
c.3139G>C p.Gly1047Arg G1047R exon 19 G to C at 3271 Gly to Arg at 1047
c.3139+18C>T 3271+ 18C/T intron 19 C or T at 3271+ 18 sequence variation
c.3139+1G>T 3271+ 1G>T intron 19 G to T at 3271+ 1 mRNA splicing defect
c.3139+8A>G 3271+ 8A>G intron 19 A to G at 3271+ 8 ? RNA splicing defect
c.3139+42A>T 3271+ 42A/T intron 19 A or T at 3271+ 42 sequence variation
c.3139+80A>T 3271+ 80A/T intron 19 A or T at 3271+ 80 Sequence variation
c.3139+101C>G 3271+ 101C/G intron 19 C or G at 3271+ 101 sequence variation
c.3139+183T>G 3271+ 183 T to G intron 19 T to G at 3271+ 183 sequence variation?
c.3139+1G>A 3271+ 1G- >A intron 19 G to A at 3271+ 1 mRNA splicing defect
c.3139_3139+1delGG p.Gly1047GlnfsX28 3271delGG exon 19 deletion of GG at 3271 framshift for exon 17b, loss of splice site
c.3139+193_3139+198delTAAT intron 19
c.3140G>A p.Gly1047Asp G1047D exon 20 G to A at 3272 Gly to Asp at 1047 and mRNA splicing defect? (CBAVD?)
c.3140-4A>G 3272- 4A- >G intron 19 A to G at 3272- 4 mRNA splicing defect?
c.3140-1G>A 3272- 1G- >A intron 19 G to A at 3272- 1 mRNA splicing defect
c.3140-11A>G 3272- 11A- >G intron 19 A to G at 3272- 11 Splicing
c.3140-9A>T 3272- 9A- >T intron 19 A to T at 3272- 9 mRNA splicing defect?
c.3140-54_3140-649del 3272- 54del704 intron 19 deletion of 704 bp from 3272- 54 deletion of exon 17b
c.3140-42G>T 3272- 42 G/T intron 19 3272 - 42 G>T sequence variation?
c.3140-26A>G 3272- 26A- >G intron 19 A to G at 3272- 26 mRNA splicing defect?
c.3140-33A>G 3272- 33A/G intron 19 A or G at 3272- 33 sequence variation
c.3142A>G p.Arg1048Gly R1048G exon 20 A to G at 3274 Arg to Gly a 1048
c.3148C>G p.Pro1050Ala exon 20
c.3151A>G p.Ile1051Val I1051V exon 20 A to G at 3283 Ile to Val at 1051
c.3154T>G p.Phe1052Val F1052V exon 20 T to G at 3286 Phe to Val at 1052
c.3158C>T p.Thr1053Ile T1053I exon 20 C to T at 3290 Thr to Ile at 1053 (CBAVD?)
c.3160C>G p.His1054Asp H1054D exon 20 C to G at 3292 His to Asp at 1054
c.3161A>G p.His1054Arg H1054R exon 20 A to G at 3293 His to Arg at 1054
c.3161A>T p.His1054Leu H1054 L exon 20 A to T at 3293 His to Leu at 1054
c.3161delA p.His1054LeufsX6 3293delA exon 20 deletion of A at 3293 frameshift
c.3169A>G p.Thr1057Ala T1057A exon 20 A to G at 3301 Thr to Ala at 1057
c.3176T>G p.Leu1059X L1059X exon 20 T to G at 3308 Leu to Stop at 1059
c.3177A>G L1059L (3309A/G) exon 20 A or G at 3309 sequence variation
c.3179A>C p.Lys1060Thr K1060T exon 20 A to C at 3311 Lys to Thr at 1060
c.3181G>C p.Gly1061Arg G1061R exon 20 G to C at 3313 Gly to Arg at 1061
c.3188_3189insCTATG p.Trp1063CysfsX22 3320ins5 exon 20 insertion of CTATG after 3320 frameshift
c.3189G>A p.Trp1063X W1063X exon 20 G to A at 3321 Trp to Stop at 1063
c.3193C>T p.Leu1065Phe L1065F exon 20 C to T at 3325 Leu to Phe at 1065
c.3194T>G p.Leu1065Arg L1065R exon 20 T to G at 3326 Leu to Arg at 1065
c.3194T>C p.Leu1065Pro L1065P exon 20 T to C at 3326 Leu to Pro at 1065
c.3196C>A p.Arg1066Ser R1066S exon 20 C to A at 3328 Arg to Ser at 1066
c.3196C>T p.Arg1066Cys R1066C exon 20 C to T at 3328 Arg to Cys at 1066
c.3197G>A p.Arg1066His R1066H exon 20 G to A at 3329 Arg to His at 1066
c.3197G>T p.Arg1066Leu R1066L exon 20 G to T at 3329 Arg to Leu at 1066
c.3199G>A p.Ala1067Thr A1067T exon 20 G to A at 3331 Ala to Thr at 1067
c.3199G>C p.Ala1067Pro A1067P exon 20 G to C at 3331 Ala en Pro at 1067
c.3199_3200delinsA p.Ala1067ThrfsX16 exon 20
c.3200C>G p.Ala1067Gly A1067G exon 20 C to G at 3332 Ala to Gly at 1067
c.3200C>A p.Ala1067Asp A1067D exon 20 C to A at 3332 Ala to Asp at 1067
c.3200C>T p.Ala1067Val A1067V exon 20 C to T at 3332 Ala to Val at 1067
c.3201C>T 3333C/T exon 20 C or T at 3333 sequence variation
c.3204C>T 3336C/T exon 20 C or T at 3336 sequence variation
c.3205G>A p.Gly1069Arg G1069R exon 20 G to A at 3337 Gly to Arg at 1069
c.3208C>T p.Arg1070Trp R1070W exon 20 C to T at 3340 Arg to Trp at 1070
c.3209G>A p.Arg1070Gln R1070Q exon 20 G to A at 3341 Arg to Gln at 1070
c.3209G>C p.Arg1070Pro R1070P exon 20 G to C at 3341 Arg to Pro at 1070
c.3211C>T p.Gln1071X Q1071X exon 20 C to T at 3343 Gln to Stop at 1071
c.3212A>C p.Gln1071Pro Q1071P exon 20 A to C at 3344 Gln to Pro at 1071
c.3213G>T p.Gln1071His Q1071H exon 20 G to T at 3345 Gln to His at 1071
c.3215C>T p.Pro1072Leu P1072L exon 20 C to T at 3347 Pro to Leu at 1072
c.3218A>G p.Tyr1073Cys Y1073C exon 20 A to G at 3350 Tyr to Cys at 1073
c.3222T>A p.Phe1074Leu F1074L exon 20 T to A at 3354 Phe to Leu at 1074
c.3229_3230delCT p.Leu1077ValfsX78 3359delCT exon 20 deletion of CT from 3359 frameshift
c.3230T>C p.Leu1077Pro L1077P exon 20 T to C at 3362 Leu to Pro at 1077
c.3233T>C p.Phe1078Ser exon 20
c.3236A>C p.His1079Pro H1079P exon 20 A to C at 3368 His to Pro at 1079
c.3238A>C p.Lys1080Gln K1080Q exon 20 3370A>C
c.3239A>G p.Lys1080Arg K1080R exon 20 A to G at 3371 Lys to Arg at 1080
c.3241G>C p.Ala1081Pro A1081P exon 20 G to C at 3373 Ala to Pro at 1081
c.3252A>G 3384A/G exon 20 A or G at 3384 sequence variation
c.3254A>G p.His1085Arg H1085R exon 20 A to G at 3386 His to Arg at 1085
c.3256A>G p.Thr1086Ala T1086A exon 20 A to G at 3388 Thr to Ala at 1086
c.3257C>T p.Thr1086Ile T1086I exon 20 C to T at 3389 Thr to Ile at 1086
c.3259G>C p.Ala1087Pro A1087P exon 20 G to C at 3391 Ala to Pro at AS 1087
c.3262A>G p.Asn1088Asp N1088D exon 20 A to G at 3394 Asn to Asp at 1088
c.3263dupA p.Asn1088LysfsX68 exon 20
c.3264delC p.Trp1089GlyfsX13 3396delC exon 20 deletion of C at 3396 frameshift
c.3266G>A p.Trp1089X W1089X exon 20 G to A at 3398 Trp to Stop at 1089
c.3274T>C p.Tyr1092His Y1092H exon 20 T to C at 3406 Tyr to His at 1092
c.3275A>G p.Tyr1092Cys Y1092C exon 20 A to G at 3407 Tyr to Cys at 1092
c.3276C>G p.Tyr1092X Y1092X(C- >G) exon 20 C to G at 3408 Tyr to Stop at 1092
c.3276C>A p.Tyr1092X Y1092X(C- >A) exon 20 C to A at 3408 Tyr to Stop at 1092
c.3278T>C p.Leu1093Pro L1093P exon 20 T to C at 3410 Leu to Pro at 1093
c.3285A>T 3417A/T exon 20 A or T at 3417 sequence variation
c.3287T>G p.Leu1096Arg L1096R exon 20 T to G at 3419 Leu to Arg at 1096
c.3287delT p.Leu1096ArgfsX6 3419delT exon 20 deletion of T at 3419 frameshift
c.3291delC p.Trp1098GlyfsX4 3423delC exon 20 deletion of C at 3423 frameshift
c.3292T>C p.Trp1098Arg W1098R exon 20 T to C at 3424 Trp to Arg at 1098
c.3293G>T p.Trp1098Leu W1098L exon 20 G to T at 3425 Trp to Leu at 1098
c.3293G>A p.Trp1098X W1098X(TAG) exon 20 G to A at 3425 Trp to Stop at 1098
c.3294delG p.Trp1098CysfsX4 3425delG exon 20 deletion of G at 3425 or 3426 frameshift
c.3294G>A p.Trp1098X W1098X(TGA) exon 20 G to A at 3426 Trp to Stop at 1098
c.3299A>C p.Gln1100Pro Q1100P exon 20 A to C at 3431 Gln to Pro at 1100
c.3302T>G p.Met1101Arg M1101R exon 20 T to G at 3434 Met to Arg at 1101
c.3302T>A p.Met1101Lys M1101K exon 20 T to A at 3434 Met to Lys at 1101
c.3304A>T p.Arg1102X R1102X exon 20 A to T at 3436 Arg to Stop at 1102
c.3306A>G 3438A/G exon 20 A or G at 3438 Sequence variation
c.3310G>T p.Glu1104X E1104X exon 20 G to T at 3442 Glu to Stop at 1104
c.3314T>G p.Met1105Arg M1105R exon 20 T to G at 3446 Met to Arg at 1105
c.3315delG p.Met1105IlefsX16 3447delG exon 20 Deleletion of G at 3447 Frameshift
c.3322G>C p.Val1108Leu V1108L exon 20 G to C at 3454 Val to Leu at 1108
c.3331_3332delinsA p.Phe1111ThrfsX10 exon 20
c.3331T>C p.Phe1111Leu F1111L exon 20 3463T>C
c.3339T>C 3471T/C exon 20 T or C at 3471 sequence variation
c.3345C>A 3477C/A exon 20 C or A at 3477 sequence variation
c.3353C>G p.Ser1118Cys S1118C exon 20 C to G at 3485 Ser to Cys at 1118
c.3353C>T p.Ser1118Phe S1118F exon 20 C to T at 3485 Ser to Phe at 1118
c.3364delA p.Thr1122GlnfsX12 3495delA exon 20 deletion of A at 3495 frameshift
c.3367G>C p.Gly1123Arg G1123R exon 20 G to C at 3499 Gly to Arg at 1123 mRNA splicing defect?
c.3367+2T>C 3499+ 2T- >C intron 20 T to C at 3499+ 2 mRNA splicing defect
c.3367+7T>G 3499+ 7T- >G intron 20 T to G at 3499+ 7 Splicing
c.3367+29G>A 3499+ 29G/A intron 20 G or A at 3499+ 29 Sequence variation
c.3367+37G>A 3499+ 37G/A intron 20 G or A at 3499+ 37 sequence variation
c.3367+3A>G 3499+ 3A- >G intron 20 A to G at 3499+ 3 mRNA splicing defect?
c.3367+45T>C 3499+ 45T/C intron 20 T or C at 3499+ 45 sequence variation
c.3367+6A>G 3499+ 6A- >G intron 20 A to G at 3499+ 6 mRNA splicing defect?
c.3368-2A>G 3500- 2A- >G intron 20 A to G at 3500- 2 mRNA splicing defect
c.3368-1G>A 3500 - 1 G to A intron 20 3500 - 1 G>A mRNA splicing defect
c.3368-44G>A 3500- 44G/A intron 20 G or A at 3500- 44 sequence variation?
c.3368-140A>C 3500- 140A/C intron 20 A or C at 3500- 140 sequence variation
c.3368-50A>C 3500- 50 A/C intron 20 3500 - 50 A>C sequence variation?
c.3371_3373delAAG p.Glu1124del E1123del exon 21 Deletion of AAG at 3503 - 3505 deletion of Glu at 1123
c.3380G>A p.Gly1127Glu G1127E exon 21 G to A at 3512 Gly to Glu at 1127
c.3382A>T p.Arg1128X R1128X exon 21 A to T at 3514 Arg to Stop at 1128
c.3386T>G p.Val1129Gly V1129G exon 21 T to G at 3518 Val to Gly at 1129
c.3386T>G p.Val1129Gly V1129G exon 21 3518T>G Val to Gly at 1129
c.3389G>C p.Gly1130Ala G1130A exon 21 G to C at 3521 Gly to Ala at 1130
c.3391A>G p.Ile1131Val 3523A- >G exon 21 A to G at 3523 Ile to Val at 1131
c.3400_3401delACinsGTA p.Thr1134Ala 3532AC- >GTA exon 21 AC to GTA from 3532 frameshift
c.3406G>A p.Ala1136Thr A1136T exon 21 G to A at 3538 Ala to Thr at 1136
c.3409A>G p.Met1137Val M1137V exon 21 A to G at 3541 Met to Val at 1137
c.3410T>C p.Met1137Thr M1137T exon 21 T to C at 3542 Met to Thr at 1137
c.3410T>G p.Met1137Arg M1137R exon 21 T to G at 3542 Met to Arg at 1137
c.3415A>G p.Ile1139Val I1139V exon 21 A to G at 3547 Ile to Val at 1139
c.3418_3420delATG p.Met1140del [delta]M1140 exon 21 deletion of 3 bp between 3550 and 3553 deletion of Met at 1140
c.3419T>A p.Met1140Lys M1140K exon 21 T to A at 3551 Met to Lys at 1140
c.3424_3425insAGTA p.Thr1142LysfsX15 3556insAGTA exon 21 insertion of AGTA after position 3556 frame shift
c.3425C>T p.Thr1142Ile T1142I exon 21 C to T at 3557 Thr to Ile at 1142
c.3430C>T p.Gln1144X Q1144X exon 21 C to T at 3562 Gln to Stop at 1144
c.3434G>A p.Trp1145X exon 21
c.3435G>A p.Trp1145X W1145X exon 21 G to A at 3567 Trp to Stop at 1154
c.3439G>A p.Val1147Ile V1147I exon 21 G to A at 3571 Val to Ile at 1147
c.3443A>G p.Asn1148Ser N1148S exon 21 A to G at 3575 Asn to Ser at 1148
c.3444C>A p.Asn1148Lys N1148K exon 21 C to A at 3576 Asn to Lys at 1148
c.3445delT p.Ser1149ProfsX3 3577delT exon 21 deletion of T at 3577 frameshift
c.3454G>C p.Asp1152His D1152H exon 21 G to C at 3586 Asp to His at 1152
c.3458T>A p.Val1153Glu V1153E exon 21 T to A at 3590 Val to Glu at 1153 (CBAVD)
c.3460G>T p.Asp1154Tyr D1154Y exon 21 G to T at 3592 Asp to Tyr at 1154
c.3461A>G p.Asp1154Gly D1154G exon 21 A to G at 3593 Asp to Gly at 1154 (CBAVD)
c.3468G>T p.Leu1156Phe L1156F exon 21 G to T at 3600 Leu to Phe at 1156
c.3468+2T>C 3600+ 2T- >C intron 21 T to C at 3600+ 2 sequence variation
c.3468+42G>A 3600+ 42G/A intron 21 G or A at 3600+ 42 sequence variation?
c.3468+5G>A 3600+ 5G- >A intron 21 G to A at 3600+ 5 mRNA splicing defect?
c.3468+2_3468+3insT 3600+ 2insT intron 21 insertion of T after 3600+ 2 mRNA splicing defect?
c.3468G>A 3600G- >A exon 21 G to A at 3600 mRNA splicing defect
c.3469-2A>G 3601- 2A- >G intron 21 A to G at 3601- 2 mRNA splicing defect
c.3469-65C>A 3601- 65C/A intron 21 C or A at 3601- 65 sequence variation
c.3469-17T>C 3601- 17T- >C intron 21 T to C at 3601- 17 mRNA splicing defect?
c.3469-20T>C 3601- 20T- >C intron 21 T to C at 3601- 20 mRNA splicing mutant?
c.3469-111G>C 3601- 111G/C intron 21 G or C at 3601- 111 sequence variation
c.3469-331_3469-295del37;3469-189_3717+3822del4260pb intron 21 - exon 22
c.3472C>T p.Arg1158X R1158X exon 22 C to T at 3604 Arg to Stop at 1158
c.3472C>A p.Arg1158Arg exon 22
c.3475T>C p.Ser1159Pro S1159P exon 22 T to C at 3607 Ser to Pro at 1159
c.3476C>T p.Ser1159Phe S1159F exon 22 C to T at 3608 Ser to Phe at 1159
c.3476C>A p.Ser1159Tyr exon 22
c.3481A>C p.Ser1161Arg S1161R exon 22 A to C at 3613 or C to G at 3615 Ser to Arg at 1161
c.3484C>T p.Arg1162X R1162X exon 22 C to T at 3616 Arg to Stop at 1162
c.3485G>T p.Arg1162Leu 3617G/T exon 22 G or T at 3617 sequence variation
c.3485_3486delGA p.Val1163LeufsX2 3617delGA exon 22 Deletion of GA from 3617 Frameshift
c.3490_3491insT p.Lys1165X 3622insT exon 22 insertion of T after 3622 frameshift
c.3494A>C p.Lys1165Thr exon 22
c.3497T>G p.Phe1166Cys F1166C exon 22 T to G at 3629 Phe to Cys at 1166
c.3497delT p.Phe1166SerfsX26 3629delT exon 22 Deletion of T at 3629 Frame shift
c.3503A>G p.Asp1168Gly D1168G exon 22 A to G at 3635 Asp to Gly at 1168
c.3504C>T 3636 C/T exon 22 C to T at 3636 sequence variation (Asp at 1168 no change)
c.3528delC p.Lys1177SerfsX15 3659delC exon 22 deletion of C at 3659 frameshift
c.3529A>T p.Lys1177X K1177X exon 22 A to T at 3661 Lys to Stop at 1177 (premature termination)
c.3530A>G p.Lys1177Arg K1177R exon 22 A to G at 3662 Lys to Arg at 1177
c.3530delA p.Lys1177SerfsX15 3662delA exon 22 deletion of A at 3662 frameshift
c.3535_3536insTCAA p.Thr1179IlefsX17 3667ins4 exon 22 insertion of TCAA after 3667 frameshift
c.3535_3538delACCA p.Thr1179AsnfsX12 3667del4 exon 22 deletion of 4 bp from 3667 frameshift
c.3540delA p.Lys1180AsnfsX12 3670delA exon 22 deletion of A at 3670 frameshift
c.3546C>G p.Tyr1182X Y1182X exon 22 C to G at 3678 Tyr to Stop at 1182
c.3556C>T p.Gln1186X Q1186X exon 22 C to T at 3688 Gln to Stop at 1186
c.3558A>G Q1186Q (3690A/G) exon 22 A or G at 3690 sequence variation
c.3564G>A 3696G/A exon 21 G to A at 3696 No change to Ser at 1188
c.3569T>A p.Val1190Asp V1190D exon 22 T to A at 3701 Val to Asp at 1190
c.3584A>C p.Asn1195Thr N1195T exon 22 A to C at 3716 Asn to Thr at 1195
c.3587C>G p.Ser1196X S1196X exon 22 C to G at 3719 Ser to Stop at 1196
c.3592delG p.Val1198X 3724delG exon 22 deletion of G at 3724 frameshift
c.3594G>T 3726G/T exon 22 G or T at 3726 sequence variation
c.3598delAinsTCT p.Lys1200SerfsX12 exon 22
c.3600A>G p.Asp1201MetfsX10 3732delA exon 22 deletion of A at 3732 and A to G at 3730 frameshift and Lys to Glu at 1200
c.3605delA p.Asp1202AlafsX9 3737delA exon 22 deletion of A at 3737 frameshift
c.3611G>A p.Trp1204X W1204X(3743G- >A) exon 22 G to A at 3743 Trp to Stop at 1204
c.3612G>A p.Trp1204X W1204X(3744G- >A) exon 22 G to A at 3744 Trp to Stop at 1204
c.3612G>A p.Trp1204X W1204X(3744G- >A) exon 22 G to A at 3744 Trp to Stop at 1204
c.3617C>G p.Ser1206X S1206X exon 22 C to G at 3749 Ser to Stop at 1206
c.3617C>A p.Ser1206X S1206X(C>A) exon 22 C to A at 3749 Ser to Stop at 1206
c.3618_3619delAG p.Gly1208ProfsX56 3750delAG exon 22 deletion of AG from 3750 frameshift
c.3623delG p.Gly1208AlafsX3 3755delG exon 22 deletion of G between 3751 and 3755 frameshift
c.3629T>A p.Met1210Lys M1210K exon 22 T to A at 3761 Met to Lys at 1210
c.3630G>A p.Met1210Ile M1210I exon 22 G to A at 3762 Met to Ile at 1210
c.3634G>A p.Val1212Ile V1212I exon 22 G to A at 3766 Val to Ile at 1212
c.3634G>T p.Val1212Phe exon 22
c.3648A>C 3780 A/C exon 22 A to C at 3780 sequence variation
c.3657_3658insA p.Thr1220AsnfsX45 3789insA exon 22 insertion of A at 3789 frameshift resulting in a premature termination at 3921
c.3659C>T p.Thr1220Ile 3791C/T exon 22 C or T at 3791 sequence variation
c.3659delC p.Thr1220LysfsX8 3791delC exon 22 deletion of C at 3791 frameshift
c.3664_3665insTCAA p.Gly1222ValfsX44 exon 22
c.3674C>T p.Ala1225Val exon 22
c.3680T>C p.Leu1227Ser L1227S exon 22 T to C at 3812 Leu to Ser at 1227
c.3681A>G p.Leu1227Leu exon 22
c.3682G>A p.Glu1228Lys E1228K exon 22 G to A at 3814
c.3683A>G p.Glu1228Gly E1228G exon 22 A to G at 3815 Glu to Gly at 1228
c.3687C>A p.Asn1229Lys exon 22
c.3689T>C p.Ile1230Thr I1230T exon 22 T to C at 3821 Ile to Thr at 1230
c.3691delT p.Ser1231ProfsX4 3821- 3823del T exon 22 deletion of T at 3821- 3823 frameshift (Stop at 1234)
c.3691delT p.Ser1231ProfsX4 3821delT exon 22 deletion of T at 3821 frameshift
c.3700A>C p.Ile1234Leu I1234L exon 22 A to C at 3832 sequence variation
c.3700A>G p.Ile1234Val I1234V exon 22 A to G at 3832 Ile to Val at 1234
c.3705T>G p.Ser1235Arg S1235R exon 22 T to G at 3837 Ser to Arg at 1235
c.3709G>A p.Gly1237Ser G1237S exon 22 G to A at 3841 Gly to Ser at 1237
c.3712C>T p.Gln1238X Q1238X exon 22 C to T at 3844 Gln to Stop at 1238
c.3713A>G p.Gln1238Arg Q1238R exon 22 A to G at 3845 Gln to Arg at 1238
c.3717G>A 3849G- >A exon 22 G to A at 3849 mRNA splicing defect?
c.3717G>C p.Arg1239Ser R1239S exon 22 G to C at 3849 Arginine to Serine at 1239
c.3717+40A>G 3849+ 40A- >G intron 22 A to G at 3849+ 40 Splicing
c.3717+45G>A 3849+ 45G- >A intron 22 G to A at 3849+ 45 Splicing
c.3717+4A>G 3849+ 4A- >G intron 22 A to G at 3849+ 4 mRNA splicing defect?
c.3717+5G>A 3849+ 5G- >A intron 22 G to A at 3849+ 5 mRNA splicing defect?
c.3717+12191C>T 3849+ 10kbC- >T intron 22 C to T in a 6.2 kb EcoRI fragment 10 kb from 19 creation of splice acceptor site
c.3717+1G>A 3849+ 1G- >A intron 22 G to A at 3849+ 1 mRNA splicing defect
c.3718-3T>G 3850- 3T- >G intron 22 T to G at 3850- 3 mRNA splicing defect
c.3718-41C>G 3850- 41C/G intron 22 3850- 41 C>G Sequence variation?
c.3718-1G>A 3850- 1G- >A intron 22 G to A at 3850- 1 mRNA splicing defect
c.3718-79T>C 3850- 79T/C intron 22 T or C at 3850- 79 sequence variation?
c.3718-39a>G intron 22
c.3718-130T>C 3850- 129T/C intron 22 T or C at 3850- 129 sequence variation
c.3719T>G p.Val1240Gly V1240G exon 23 T to G at 3851 Val to Gly at 1240
c.3728_3758del 3860ins31 exon 23 insertion of 31 bp after 3860 frameshift
c.3730G>A p.Gly1244Arg G1244R exon 23 G to A at 3862 Gly to Arg at 1244
c.3731G>A p.Gly1244Glu G1244E exon 23 G to A at 3863 Gly to Glu at 1244
c.3731G>T p.Gly1244Val G1244V exon 23 G to T at 3863 Gly to Val at 1244
c.3735A>G 3867A/G exon 23 A or G at 3867 sequence variation
c.3737C>T p.Thr1246Ile T1246I exon 23 C to T at 3869 Thr to Ile at 1246 (mutation?)
c.3739G>A p.Gly1247Arg G1247R(G- >A) exon 23 G to A at 3871 Gly to Arg at 1247
c.3739G>C p.Gly1247Arg G1247R(G- >C) exon 23 G to C at 3871 Gly to Arg at 1247
c.3744delA p.Lys1250ArgfsX9 3876delA exon 23 deletion of A at 3876 frameshift
c.3745G>A p.Gly1249Arg G1249R exon 23 G to A at 3877 Gly to Arg at 1249
c.3746G>A p.Gly1249Glu G1249E exon 23 G to A at 3878 Gly to Glu at 1249
c.3747delG p.Lys1250ArgfsX9 3878delG exon 23 deletion of G at 3878 frameshift mutation at 1249 and stop codon at 1258
c.3752G>A p.Ser1251Asn S1251N exon 23 G to A 3884 Ser to Asn at 1251
c.3754A>C p.Thr1252Pro T1252P exon 23 A to C at 3886 Thr to Pro at 1252
c.3759G>A 3891 G/A exon 23 G or A at 3891 Sequence Variation
c.3759G>C p.Leu1253Phe L1253F exon 23 3891G>C
c.3761T>G p.Leu1254X L1254X exon 23 T to G at 3893 Leu to Stop at 1254
c.3762A>T p.Leu1254Phe exon 23
c.3763T>C p.Ser1255Pro S1255P exon 23 T to C at 3895 Ser to Pro at 1255
c.3764C>T p.Ser1255Leu S1255L exon 23 C to T at 3896 Ser to Leu at 1255
c.3764C>A p.Ser1255X S1255X exon 23 C to A at 3896 and A to G at 3739 in exon 19 Ser to Stop at 1255 and Ile to Val at 1203
c.3766_3767insC p.Leu1258PhefsX7 3898insC exon 23 insertion of C after 3898 frameshift
c.3767C>T p.Ala1256Val A1256V exon 23 3899C>T
c.3771T>G p.Phe1257Leu F1257L exon 23 T to G at 3903 Phe to Leu at 1257
c.3773_3774insT p.Leu1258PhefsX7 3905insT exon 23 insertion of T after 3905 frameshift
c.3774_3775insG p.Arg1259GlufsX6 3906insG exon 23 insertion of G after 3906 frameshift
c.3780_3782delACT p.Leu1261del [delta]L1260 exon 23 deletion of ACT from either 3909 or 3912 deletion of Leu at 1260 or 1261
c.3779T>G p.Leu1260Arg L1260R exon 23 T to G at 3911 Leu to Arg at 1260
c.3787A>G p.Thr1263Ala T1263A exon 23 A to G at 3919 Thr to Ala at 1263
c.3788C>T p.Thr1263Ile T1263I exon 23 C to T at 3920 Thr to Ile at 1263
c.3790_3799delGAAGGAGAAA p.Glu1264SerfsX11 3922del10- >C exon 23 deletion of 10 bp from 3922 and replacement with 3921 deletion of Glu1264 to Glu1266
c.3800T>A p.Ile1267Asn exon 23
c.3803A>G p.Gln1268Arg Q1268R exon 23 A to G at 3935 Gln to Arg at 1268
c.3806T>A p.Ile1269Asn I1269N exon 23 T to A at 3938 Ile to Asn at 1269
c.3807C>T 3939C/T exon 23 C or T at 3939 sequence variation
c.3808G>A p.Asp1270Asn D1270N exon 23 G to A at 3940 Asp to Asn at 1270
c.3808G>T p.Asp1270Tyr D1270Y exon 23 G to T at 3940 Asp to Tyr at 1270
c.3816_3817delGT p.Ser1273LeufsX28 3944delGT exon 23 deletion of GT from 394