| 
 
 | 
	
	| Mutation Details for c.3747delG  |  | 
	    
	        | cDNA Name | c.3747delG |  
	        | Protein Name | p.Lys1250ArgfsX9 |  
	        | Exon or Intron | exon 23 |  
	        | Legacy Exon or Intron | exon 20 |  
	        |  | 3878delG |  
	        | Other Details | We have found at nucleotide 3878 the deletion of a G in a patient with pancreatitis. To our knowledge this mutation has not been described previously. The mutation was detected by DGGE and heteroduplex analysis. It was identified by cloning and sequencing. It was confirmed by restriction site generated PCR:  F modified primer 5' CTTGGGAAGAACTGGATCCG 3' creates a Scr FI site that is destroyed by the mutation. |  
		        | Contributors | Gomez Lira M,
Marzari G,
Pignatti P F  
					1999-04-30 |  
		        | Institute | Institute of Biology and Genetics
University of Verona,
Italy |  
	    
		
	        | Submitted Phenotype Details | The 14 years old male patient with pancreatitis carries 3849+10kbC->T on the other allele.(Castellani et al. 2001) |  
	        | Reference | Gomez Lira et al. 1999 |  To check if there are any papers published about this mutation/variant on PubMed, please click here.
 
 |  |  |  | 
 |