Mutation Details for c.54_273delCTGGACCAGACCAATTTTGAGGAAAGGATACAGACAGCGCCTGGAATTGTCAGACATATACCAAATCCCTTCTGTTGATTCTGCTGACAATCTATCTGAAAAATTGGAAAGAGAATGGGATAGAGAGCTGGCTTCAAAGAAAAATCCTAAACTCATTAATGCCCTTCGGCGATGTTTTTTCTGGAGATTTATGTTCTATGGAATCTTTTTATATTTAGGG

Note: this mutation was submitted but not yet reviewed by our curator.
cDNA Name c.54_273delCTGGACCAGACCAATTTTGAGGAAAGGATACAGACAGCGCCTGGAATTGTCAGACATATACCAAATCCCTTCTGTTGATTCTGCTGACAATCTATCTGAAAAATTGGAAAGAGAATGGGATAGAGAGCTGGCTTCAAAGAAAAATCCTAAACTCATTAATGCCCTTCGGCGATGTTTTTTCTGGAGATTTATGTTCTATGGAATCTTTTTATATTTAGGG 
Protein Name p.Ser18ArgfsX16 
Exon or Intron  
Other Details The second mutation in the patient was not detected by Sanger sequencing of all 27 exons or MLPA. 
Contributors and Institutes
1. Keqiang Liu - McKusick-Zhang Center for Genetic Medicine, State Key Laboratory of Medical Molecular Biology, Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences & Peking Union Medical College
2. Yaping Liu - McKusick-Zhang Center for Genetic Medicine, State Key Laboratory of Medical Molecular Biology, Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences & Peking Union Medical College
3. Xinlun Tian - Department of Pulmonary and Critical Care Medicine, Peking Union Medical College Hospital, Chinese Academy of Medical Sciences & Peking Union Medical College
4. Kai-Feng Xu - Department of Pulmonary and Critical Care Medicine, Peking Union Medical College Hospital, Chinese Academy of Medical Sciences & Peking Union Medical College
5. Xue Zhang - McKusick-Zhang Center for Genetic Medicine, State Key Laboratory of Medical Molecular Biology, Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences & Peking Union Medical College
  
Submitted Phenotype Details Age at diagnosis: 18 Age at onset: 11 Ethnicity: Chinese Geographic region: Asia-China Sweat chloride level: 120 mmol/l Pancreatic statu: Pancreatic sufficiency Lung disease: FEV1 % pred 49.2%；FEV1/FVC 75.7% Infection: Pseudomonas aeruginosa, methicillin-resistant Staphylococcus aureus 
Reference Unpublished 

To check if there are any papers published about this mutation/variant on PubMed, please click here.




Comments or questions? Please email to cftr.admin
The Database was last updated at Apr 25, 2011