The cystic fibrosis transmembrane conductance regulator (CFTR) is a 1480 amino acid membrane bound glycoprotein with a molecular mass of 170,000. It is a member of the ATP binding cassette (ABC)superfamily of proteins. The protein is comprised of two, six span membrane bound regions each connected to a nuclear binding factor which binds ATP. Between these two units is an R-domain which is comprised of many charged amino acids. The R-domain is a unique feature of CFTR within the ABC superfamily.

Put your mouse over the domain region in the following graph to view the summary of that domain, click to view the details.



Many of the mutations identified in CF occur in the first nuclear binding domain (NBF1), while very few occur in NBF2. This is a common feature of the ABC superfamily and indicates a separate role for the two binding domains. The most common mutation in CF DF508 occurs in NBF1. This results in a 3 bp deletion and the loss of a phenylalanine residue. The deletion causes a protein trafficking defect. If this defect is overcome then the protein can form a functional channel. This can be brought about by overexpression of CFTR or by culturing cells at > 30 oC. The NBFs contain a number of highly conserved motifs predicted to bind and hydrolyse ATP. Site directed mutagenesis at these motifs have indicated that ATP binds to both NBFs to control the gating of the channel.

The mutations happenning in NBD1 domain:

cDNA Name Protein Name Legacy Name Region Description Consequence
c.1429C>T p.Pro477Ser exon 11
c.1433_1434delCA p.Ser478X 1565 del CA exon 11 deletion of CA from 1565 frameshift
c.1435G>T p.Glu479X E479X exon 11 G to T at 1567 Glu to Stop at 479
c.1437G>C p.Glu479Asp
c.1438G>T p.Gly480Cys G480C exon 11 G to T at 1570 Gly to Cys at 480
c.1438G>A p.Gly480Ser G480S exon 11 G to A at 1570 Gly to Ser at 480
c.1439delG p.Gly480ValfsX47 1571delG exon 11 deletion of G at 1571 frameshift
c.1439G>A p.Gly480Asp G480D exon 11 G to A at 1571 Gly to Asp at 480
c.1440T>C 1572T/C exon 11 T or C at 1572 sequence variation
c.1444_1445insT p.Lys483X 1576insT exon 11 insertion of T at 1576 framshift
c.1450C>T p.His484Tyr H484Y exon 11 C to T at 1582 His to Tyr at 484 (CBAVD?)
c.1451A>G p.His484Arg H484R exon 11 A to G at 1583 His to Arg at 484
c.1453A>T p.Ser485Cys S485C exon 11 A to T at 1585 Ser to Cys at 485
c.1454G>C p.Ser485Thr S485T exon 11 G to C at 1586
c.1456G>T p.Gly486X G486X exon 11 G to T at 1588 Gly to Stop at 486
c.1465_1468delTCAT p.Phe490ValfsX36
c.1466C>A p.Ser489X S489X exon 11 C to A at 1598 Ser to Stop at 489
c.1469_1470delTC p.Phe490LeufsX13 1601delTC exon 11 deletion of TC from 1601 or CT from 1602 frameshift
c.1469delT p.Phe490Serfs*37 exon 11
c.1471T>C p.Cys491Arg C491R exon 11 T to C at 1603 Cys to Arg at 491
c.1472G>C p.Cys491Ser exon 11
c.1472G>T p.Cys491Phe
c.1475C>T p.Ser492Phe S492F exon 11 C to T at 1607 Ser to Phe at 492
c.1477_1478delCA p.Gln493ValfsX10 1609delCA exon 11 deletion of CA from 1609 frameshift
c.1477C>T p.Gln493X Q493X exon 11 C to T at 1609 Gln to Stop at 493
c.1478A>C p.Gln493Pro Q493P exon 11 A to C at 1610 Gln to Pro at 493
c.1478A>G p.Gln493Arg Q493R exon 11 A to G at 1610 Gln to Arg at 493
c.1482_1483delTT p.Ser495LeufsX8 1612delTT exon 11 deletion of TT from 1612 frameshift
c.1484C>A p.Ser495Tyr exon 11
c.1486T>C p.Trp496Arg
c.1487G>A p.Trp496X W496X exon 11 G to A at 1619 Trp to Stop at 496
c.1489A>G p.Ile497Val I497V exon 11 A to G at 1621 Ile to Val at 497
c.1494G>C p.Met498Ile M498I exon 11 G to C at 1626 Met (ATG) to Ileu (ATC) at 498
c.1495C>G p.Pro499Ala P499A exon 11 C to G at 1627 Pro to Ala at 499 (CBAVD)
c.1501A>G p.Thr501Ala T501A exon 11 A to G at 1633 Thr to Ala at 501
c.1505T>A p.Ile502Asn I502N exon 11 T to A at 1637 Ile to Asn at 502
c.1505T>C p.Ile502Thr I502T exon 11 T to C at 1637 Ile to Thr at 502
c.1510G>C p.Glu504Gln E504Q exon 11 G to C at 1642 Glu to Gln at 504
c.1510G>T p.Glu504X E504X exon 11 G to T at 1642 Glu to Stop at 504
c.1519_1521delATC p.Ile507del [delta]I507 exon 11 deletion of 3 bp between 1648 and 1653 deletion of Ile506 or Ile507
c.1516A>C p.Ile506Leu I506L exon 11 A to C at 1648 Ile to Leu at 506
c.1516A>G p.Ile506Val I506V (1648A/G) exon 11 A or G at 1648 Ile or Val at 506
c.1517T>G p.Ile506Ser I506S exon 11 T to G at 1649 Ile to Ser at 506
c.1517T>C p.Ile506Thr I506T exon 11 T to C at 1649 Ile to Thr at 506
c.1518C>G p.Ile506Met 1650C/G exon 11 C to G at 1650 Ile to Met at 506; sequence variation
c.1519A>G p.Ile507Val 1651A/G exon 11 A or G at 1651 sequence variation
c.1521_1523delCTT p.Phe508del [delta]F508 exon 11 deletion of 3 bp between 1652 and 1655 deletion of Phe at 508
c.1521C>G p.Ile507Met exon 11
c.1523T>G p.Phe508Cys F508C exon 11 T to G at 1655 Phe to Cys at 508
c.1523T>C p.Phe508Ser F508S exon 11 T to C at 1655 Phe to Ser at 508
c.1526G>A p.Gly509Asp
c.1528delG p.Val510PhefsX17 1660delG exon 11 Deletion of G at 1660 frameshift
c.1532C>G p.Ser511Cys exon 11
c.1538A>G p.Asp513Gly D513G exon 11 A to G at 1670 Asp to Gly at 513 (CBAVD)
c.1540G>A p.Glu514Lys
c.1540G>C p.Glu514Gln
c.1543T>C p.Tyr515His Y515H exon 11 T to C at 1675 Tyr to His at 515
c.1545_1546delTA p.Tyr515X 1677delTA exon 11 deletion of TA from 1677 frameshift
c.1546A>G p.Arg516Gly R516G exon 11 A to G at 1678 Arg to Gly at 516
c.1549T>C p.Tyr517His
c.1550A>G p.Tyr517Cys Y517C exon 11 A to G at 1682 Tyr to Cys at 517
c.1555A>G p.Ser519Gly S519G exon 11 A to G at 1687 Ser to Gly at 519
c.1558G>T p.Val520Phe V520F exon 11 G to T at 1690 Val to Phe at 520
c.1558G>A p.Val520Ile V520I exon 11 G to A at 1690 Val to Ile at 520
c.1561A>C p.Ile521Leu 1693A- >C exon 11 A to C at 1693 Ile to Leu at 521 (sequence variation?)
c.1561A>T p.Ile521Phe exon 11
c.1567G>T p.Ala523Ser exon 11
c.1572C>A p.Cys524X C524X exon 11 C to A at 1704 Cys to Stop at 524
c.1573C>T p.Gln525X Q525X exon 11 C to T at 1705 Gln to Stop at 525
c.1573delC p.Gln525AsnfsX2
c.1574_1590delAACTAGAAGAGGACATC p.Gln525LeufsX37 1706del17 exon 11 deletion of 17 bp from 1706 deletion of splice site
c.1579G>C p.Glu527Gln E527Q exon 11 G to C at 1711 Glu to Gln at 527
c.1580A>G p.Glu527Gly E527G exon 11 A to G at 1712 Glu to Gly at 527
c.1581A>G 1713A/G exon 11 A or G at 1713 sequence variation
c.1582G>A p.Glu528Lys E528K exon 11 G to A at 1714 Glu to Lys at 528
c.1584G>A 1716G/A exon 11 G or A at 1716 sequence variation
c.1584G>T p.Glu528Asp E528D exon 11 G to T at 1716 Glu to Asp at 528 (splice mutation?)
c.1585G>C p.Asp529His D529H exon 12 G to C at 1717 Asp to His at 529
c.1586A>G p.Asp529Gly D529G exon 12 A to G at 1718 Asp to Gly at 529
c.1588A>C p.Ile530Leu exon 12
c.1597T>G p.Phe533Val
c.1597T>C p.Phe533Leu
c.1601C>A p.Ala534Glu A534E exon 12 C to A at 1733 Ala to Glu at 534
c.1606A>G p.Lys536Glu K536E exon 12 A to G at 1738
c.1606A>T p.Lys536X K536X exon 12 A to T at 1738 Lys to Stop codon at 536
c.1610_1611delAC p.Asp537GlufsX30 1742delAC exon 12 deletion of AC from 1742 frameshift
c.1611C>A p.Asp537Glu D537E exon 12 C to A or C to G at 1743 Asp to Glu at 537
c.1616T>C p.Ile539Thr I539T exon 12 T to C at 1748 Ile to Thr at 539
c.1617_1618insTA p.Val540X 1749insTA exon 12 insertion of TA at 1749 frameshift resulting in premature termination at 540
c.1622T>C p.Leu541Pro exon 12
c.1624G>T p.Gly542X G542X exon 12 G to T at 1756 Gly to Stop at 542
c.1625G>A p.Gly542Glu G542E exon 12 1757G>A
c.1630G>A p.Gly544Ser G544S exon 12 G to A at 1762 Gly to Ser at 544
c.1631G>T p.Gly544Val G544V exon 12 G to T at 1763 Gly to Val at 544 (CBAVD)
c.1632T>G 1764T/G exon 12 T or G at 1764 sequence variation
c.1635_1640del p.Ile546_Thr547del 1767del6 exon 12 delete 6 nucleotide from 1767 In frame in/del
c.1641A>T 1773A/T exon 12 A or T at 1773 sequence variation
c.1642_1643delCT p.Leu548GlufsX19 1774delCT exon 12 deletion of CT from 1774 frameshift
c.1643T>A p.Leu548Gln L548Q exon 12 T to A at 1775 Leu to Gln at 548
c.1645A>C p.Ser549Arg S549R(A- >C) exon 12 A to C at 1777 Ser to Arg at 549
c.1645_1648delAGTG p.Ser549GlufsX9 exon 12
c.1646G>T p.Ser549Ile S549I exon 12 G to T at 1778 Ser to Ile at 549
c.1646G>A p.Ser549Asn S549N exon 12 G to A at 1778 Ser to Asn at 549
c.1647T>G p.Ser549Arg S549R(T- >G) exon 12 T to G at 1779 Ser to Arg at 549
c.1648G>A p.Gly550Arg G550R exon 12 G to A at 1780 Gly to Arg at 550
c.1648G>T p.Gly550X G550X exon 12 G to T at 1780 Gly to Stop at 550
c.1650delA p.Gly551ValfsX8 1782delA exon 12 deletion of A at 1782 frameshift
c.1651G>A p.Gly551Ser G551S exon 12 G to A at 1783 Gly to Ser at 551
c.1652delG p.Gly551ValfsX8 1784delG exon 12 deletion of G at 1784 frameshift
c.1652G>A p.Gly551Asp G551D exon 12 G to A at 1784 Gly to Asp at 551
c.1654C>A p.Gln552Lys Q552K exon 12 C to A at 1786 Gln to Lys at 552
c.1654C>T p.Gln552X Q552X exon 12 C to T at 1786 Gln to Stop at 552
c.1656delA p.Gln552HisfsX7 1787delA exon 12 deletion of A at position 1787 or 1788 frameshift, stop codon at 558
c.1657C>G p.Arg553Gly R553G exon 12 C to G at 1789 Arg to Gly at 553
c.1657C>T p.Arg553X R553X exon 12 C to T at 1789 Arg to Stop at 553
c.1658G>A p.Arg553Gln R553Q exon 12 G to A at 1790 Arg to Gln at 553 (associated with [delta]F508;
c.1660_1661insA p.Ala554AspfsX14 exon 12
c.1663A>G p.Arg555Gly R555G exon 12 A to G at 1795 Arg to Gly at 555
c.1666A>G p.Ile556Val I556V exon 12 A to G at 1798 Ile to Val at 556 (mutation?)
c.1670delC p.Ser557PhefsX2 1802delC exon 12 deletion of C at 1802 frameshift
c.1673T>C p.Leu558Ser L558S exon 12 T to C at 1805 Leu to Ser at 558
c.1674delA p.Ala559GlnfsX13 1806delA exon 12 deletion of A at 1806 frameshift
c.1675G>A p.Ala559Thr A559T exon 12 G to A at 1807 Ala to Thr at 559
c.1676C>A p.Ala559Glu A559E exon 12 C to A at 1808 Ala to Glu at 559
c.1676C>T p.Ala559Val A559V exon 12 C to T at 1808 Ala to Val at 559
c.1678A>G p.Arg560Gly R560G exon 12 A to G at 1810 Ala to Gly at 560
c.1679G>A p.Arg560Lys R560K exon 12 G to A at 1811 Arg to Lys at 560
c.1679G>C p.Arg560Thr R560T exon 12 G to C at 1811 Arg to Thr at 560; mRNA splicing defect?
c.1680A>C p.Arg560Ser R560S exon 13 A to C at 1812 Arg to Ser at 560
c.1681_1682insC p.Val562SerfsX6 1813insC exon 13 insertion of C after 1813 (or 1814) frameshift
c.1682C>A p.Ala561Glu A561E exon 13 C to A at 1814 Ala to Glu at 561
c.1684G>A p.Val562Ile V562I exon 13 G to A at 1816 Val to Ile at 562
c.1684G>C p.Val562Leu V562L exon 13 G to C at 1816 Val to Leu at 562
c.1687T>G p.Tyr563Asp Y563D exon 13 T to G at 1819 Tyr to Asp at 563
c.1687T>A p.Tyr563Asn Y563N exon 13 T to A at 1819 Tyr to Asn at 563
c.1687T>C p.Tyr563His
c.1688A>G p.Tyr563Cys Y563C exon 13 A to G at 1820 Tyr to Cys at 563
c.1690A>G p.Lys564Glu exon 13 A to G at 1690
c.1692delA p.Asp565MetfsX7 1824delA exon 13 1824delA
c.1694A>G p.Asp565Gly D565G exon 13 A to G at 1826 Asp to Gly at 565
c.1696G>A p.Ala566Thr A566T exon 13 G to A at 1828 Ala to Thr at 566
c.1697C>A p.Ala566Asp
c.1700A>G p.Asp567Gly exon 13
c.1703delT p.Leu568CysfsX4 1833delT exon 13 deletion of T at 1833 frameshift
c.1703T>A p.Leu568X L568X exon 13 T to A at 1835 Leu to Stop at 568
c.1704G>T p.Leu568Phe L568F exon 13 G to T at 1836 Leu to Phe at 568 (CBAVD?)
c.1705T>G p.Tyr569Asp Y569D exon 13 T to G at 1837 Tyr to Asp at 569
c.1705T>C p.Tyr569His Y569H exon 13 T to C at 1837 Tyr to His at 569
c.1706A>G p.Tyr569Cys Y569C exon 13 A to G at 1838 Tyr to Cys at 569
c.1707T>A p.Tyr569X Y569X exon 13 T to A at 1839 Tyr to Stop at 569
c.1712T>C p.Leu571Ser L571S exon 13 T to C at 1844 Leu to Ser at 571
c.1713_1714delAG p.Asp572LeufsX16 1845delAG/1846delGA exon 13 deletion of AG at 1845 or GA at 1846 frameshift
c.1714G>A p.Asp572Asn D572N exon 13 G to A at 1846 Asp to Asn at 572
c.1714G>C p.Asp572His exon 13
c.1718C>G p.Ser573Cys S573C exon 13 C to G at 1850 Ser to Cys at 573
c.1718C>T p.Ser573Phe
c.1720C>T p.Pro574Ser P574S exon 13 C to T at 1852 Pro to Ser at 574
c.1721C>A p.Pro574His P574H exon 13 C to A at 1853 Pro to His at 574
c.1726G>T p.Gly576X G576X exon 13 G to T at 1858 Gly to Stop at 576
c.1727G>C p.Gly576Ala G576A exon 13 G to C at 1859 Gly to Ala at 576 (CAVD)
c.1730A>T p.Tyr577Phe Y577F exon 13 A to T at 1862 Tyr to Phe at 577
c.1731C>T Y577Y (1863C/T) exon 13 C or T at 1863 sequence variation (Tyr at 577 no change)
c.1731C>A p.Tyr577X exon 13
c.1735G>T p.Asp579Tyr D579Y exon 13 G to T at 1867 Asp to Tyr at 579
c.1736A>C p.Asp579Ala D579A exon 13 A to C at 1868 Asp to Ala at 579
c.1736A>G p.Asp579Gly D579G exon 13 A to G at 1868 Asp to Gly at 579
c.1738delG p.Val580PhefsX2 1870delG exon 13 deletion of G at 1870 frameshift
c.1739_1740insT p.Leu581PhefsX8 1874insT exon 13 insertion of T between 1871 and 1874 frameshift
c.1744A>T p.Thr582Ser T582S exon 13 A to T at 1876 Thr to Ser at 582
c.1745C>T p.Thr582Ile T582I exon 13 C to T at 1877 Thr to Ile at 582
c.1745C>G p.Thr582Arg T582R exon 13 C to G at 1877 Thr to Arg at 582
c.1753G>T p.Glu585X E585X exon 13 G to T at 1885 Glu to Stop at 585
c.1756A>G p.Ile586Val I586V exon 13 A to G at 1888 Ile to Val at 586
c.1759T>A p.Phe587Ile F587I exon 13 T to A at 1891 Phe to Ile at 587
c.1763A>T p.Glu588Val E588V exon 13 A to T at 1895 Glu to Val at 588
c.1766G>T p.Ser589Ile S589I exon 13 G to T at 1898 Ser to Ile at 589 (splicing?)
c.1766G>A p.Ser589Asn S589N exon 13 G to A at 1898 Ser to Asn at 589 (mRNA splicing defect?)
c.53+642c>A
c.1781T>C p.Leu594Pro L594P exon 14 T to C at 1913 Leu to Pro at 594
c.1783A>G p.Met595Val exon 14
c.1784T>C p.Met595Thr M595T exon 14 T to C at 1916 Met to Thr at 595
c.1785G>A p.Met595Ile M595I exon 14 G to A at 1917 Met to Ile at 595
c.1786_1787delGC p.Ala596X 1918delGC exon 14 deletion of GC from 1918 frameshift
c.1792_1798delAAAACTA p.Lys598GlyfsX11 1924del7 exon 14 deletion of 7 bp (AAACTA) from 1924 frameshift
c.1792A>T p.Lys598X K598X exon 14 A to T at 1924 Lys to Stop at 598
c.1797T>A T599T (1929T/A) exon 14 T or A at 1929 sequence variation
c.1798A>G p.Arg600Gly R600G exon 14 A to G at 1930 Arg to Gly at 600
c.1800delG p.Ile601PhefsX10 1932delG exon 14 Deletion of G at nucleotide 1932 Frameshift a premature stop codon appears 10 codons further.
c.1801A>T p.Ile601Phe I601F exon 14 A to T at 1933 Ile to Phe at 601
c.1801A>G p.Ile601Val
c.1807G>T p.Val603Phe V603F exon 14 G to T at 1939 Val to Phe at 603
c.1811C>T p.Thr604Ile T604I exon 14 C to T at 1943 Thr to Ile at 604
c.1811C>G p.Thr604Ser T604S exon 14 C to G at 1943 Thr to Ser at 604
c.1817_1900delAAATGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCC p.Met607_Gln634del 1949del84 exon 14 deletion of 84 bp from 1949 deletion of 28 a.a. (Met607 to Gln634)
c.1819_1902delATGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCCAA p.Met607_Gln634del
c.1823A>G p.Glu608Gly E608G exon 14 A to G at 1955 Glu to Gly at 608
c.1826A>T p.His609Leu H609L exon 14 A to T at 1958 His to Leu at 609
c.1826A>G p.His609Arg H609R exon 14 A to G at 1958 His to Arg at 609
c.1829T>C p.Leu610Ser L610S exon 14 T to C at 1961 Leu to Ser at 610
c.1837G>A p.Ala613Thr A613T exon 14 G to A at 1969 Ala to Thr at 613
c.1840G>T p.Asp614Tyr D614Y exon 14 G to T at 1972 Asp to Tyr at 614
c.1841A>G p.Asp614Gly D614G exon 14 A to G at 1973 Asp to Gly at 614
c.1853T>C p.Ile618Thr I618T exon 14 T to C at 1985 Ile to Thr at 618
c.1856T>C p.Leu619Ser L619S exon 14 T to C at 1988 Leu to Ser at 619
c.1859A>C p.His620Pro H620P exon 14 A to C at 1991 His to Pro at 620
c.1860T>G p.His620Gln H620Q exon 14 T to G at 1992 His to Gln at 620
c.1865G>A p.Gly622Asp G622D exon 14 G to A at 1997 Gly to Asp at 622 (oligospermia)
c.1871_1878delGCTATTTT p.Ser624IlefsX15 2003del8 exon 14 Deletion of GCTATTTT from 2003 Frameshift
c.1874_1875delAT p.Tyr625PhefsX16
c.1882G>A p.Gly628Arg G628R(G- >A) exon 14 G to A at 2014 Gly to Arg at 628
c.1882G>C p.Gly628Arg G628R(G- >C) exon 14 G to C at 2014 Gly to Arg at 628




Comments or questions? Please email to cftr.admin
The Database was last updated at Apr 25, 2011